Correction: Corrigendum: Characterization of a P1-like bacteriophage carrying CTX-M-27 in Salmonella spp. resistant to third generation cephalosporins isolated from pork in China

Abstract

This Article contains errors in the Materials and Methods section under subheading 'Prevalence investigation of P1-like bacteriophage in Salmonella isolates' , where incorrect primers were quoted. "The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)". should read: "The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IR-fw-(GTTGCTGGCTGACGCCTATGAAG) and IR-rev-(ATGTTTGCCATTTCATAGGGGAG)".

IS 26 Is Responsible for the Evolution and Transmission of bla NDM -Harboring Plasmids in Escherichia coli of Poultry Origin in China

“…Transconjugants were selected on MacConkey agar containing 150 mg/liter sodium azide and 0.5 mg/liter meropenem. For isolates where no transconjugants were obtained, an alternative E. coli (DH5α) was used as a recipient for transformation experiments ( 40 ), and transformants were selected for on Luria-Bertani (LB) agar containing 0.5 mg/liter meropenem. The presence of bla NDM in transconjugants/transformants was further confirmed by PCR and sequencing.…”

Increased Drug Resistance and Biofilm Formation Ability in ST34-Type Salmonella Typhimurium Exhibiting Multicellular Behavior in China

“…Salmonella has been reported to be the leading cause of death among food-borne bacterial pathogens in some countries (Casey et al, 2011) with 94 million infections annually and 155,000 deaths globally (Hendriksen et al, 2011). S. Typhimurium is one of the dominant serotypes among the >2,500 recognized Salmonella serotypes (Popoff et al, 2001;Liang et al, 2015;Yang et al, 2017). Furthermore, S. Typhimurium has numerous hosts and is widely distributed; it can not only infect animals but is also transmitted to humans through contaminated food (Adagbada et al, 2014) and the mortality caused by S. Typhimurium is 3-fold higher than the average mortality associated with Salmonella (Angulo and Kre, 2005).…”