Repression of poly(A)-binding protein (PABP) mRNA translation involves the binding of PABP to the adenine-rich autoregulatory sequence (ARS) in the 5′-untranslated region of its own mRNA. In this report, we show that the ARS forms a complex in vitro with PABP, and two additional polypeptides of 63 and 105 kDa. The 63 and 105 kDa polypeptides were identified, as IMP1, an ortholog of chicken zip-code binding polypeptide, and UNR, a PABP binding polypeptide, respectively, by mass spectrometry of the ARS RNA affinity purified samples. Using a modified ribonucleoprotein (RNP) immunoprecipitation procedure we further show that indeed, both IMP1 and UNR bind to the ARS containing reporter RNA in vivo. Although both IMP1 and UNR could bind independently to the ARS RNA in vitro, their RNA-binding ability was stimulated by PABP. Mutational analyses of the ARS show that the presence of four of the six oligo(A) regions of the ARS was sufficient to repress translation and the length of the conserved pyrimidine spacers between the oligo(A) sequences was important for ARS function. The ability of mutant ARS RNAs to form the PABP, IMP1 and UNR containing RNP complex correlates well with the translational repressor activity of the ARS. There is also a direct relationship between the length of the poly(A) RNAs and their ability to form a trimeric complex with PABP, and to repress mRNA translation. UV crosslinking studies suggest that the ARS is less efficient than a poly(A) RNA of similar length, to bind to PABP. We show here that the ARS cannot efficiently form a trimeric complex with PABP; therefore, additional interactions with IMP1 and UNR to form a heteromeric RNP complex may be required for maximal repression of PABP mRNA translation under physiological conditions.
BackgroundUtrophin is the autosomal homolog of dystrophin, the product of the Duchenne Muscular Dystrophy (DMD) locus. Its regulation is of therapeutic interest as its overexpression can compensate for dystrophin's absence in animal models of DMD. The tissue distribution and transcriptional regulation of utrophin have been characterized extensively, and more recently translational control mechanisms that may underlie its complex expression patterns have begun to be identified.Methodology/Principal FindingsUsing a variety of bioinformatic, molecular and cell biology techniques, we show that the muscle isoform utrophin-A is predominantly suppressed at the translational level in C2C12 myoblasts. The extent of translational inhibition is estimated to be ∼99% in C2C12 cells and is mediated by both the 5′- and 3′-UTRs of the utrophin-A mRNA. In this study we identify five miRNAs (let-7c, miR-150, miR-196b, miR-296-5p, miR-133b) that mediate the repression, and confirm repression by the previously identified miR-206. We demonstrate that this translational repression can be overcome by blocking the actions of miRNAs, resulting in an increased level of utrophin protein in C2C12 cells.Conclusions/SignificanceThe present study has identified key inhibitory mechanisms featuring miRNAs that regulate utrophin expression, and demonstrated that these mechanisms can be targeted to increase endogenous utrophin expression in cultured muscle cells. We suggest that miRNA-mediated inhibitory mechanisms could be targeted by methods similar to those described here as a novel strategy to increase utrophin expression as a therapy for DMD.
Repression of poly(A)‐binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin‐like growth factor II mRNA binding protein‐1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine‐rich autoregulatory sequence (ARS) located at the 5′ untranslated region of the PABP‐mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C‐terminal PABP‐C and K‐homology (KH) III‐IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA‐binding domains, whereas KH III‐IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide‐long CCCAAAAAAAUUUACAAAAAA sequence located at the 3′ end of the ARS. Results of our analysis suggest that both protein·protein and protein·RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.
Duchenne muscular dystrophy (DMD) is a devastating muscle-wasting disease caused by mutations in the dystrophin gene. Utrophin is a homologue of dystrophin that can compensate for its absence when overexpressed in DMD animal models. Utrophin upregulation is therefore a promising therapeutic approach for DMD. Utrophin is regulated at both transcriptional and posttranscriptional levels. Transcriptional regulation has been studied extensively, and assays have been described for the identification of utrophin promoter-targeting molecules. However, despite the profound impact that posttranscriptional regulation has on utrophin expression, screening assays have not yet been described that could be used to discover pharmaceuticals targeting this key phase of regulation. We describe the development and validation of a muscle cell linebased assay in which a stably expressed luciferase coding sequence is flanked by the utrophin 5′-and 3′-untranslated regions (UTRs). The assay was validated using the posttranscriptional regulation of utrophin by miR-206. The assay has a Z′ of 0.7, indicating robust performance in high-throughput format. This assay can be used to study utrophin regulatory mechanisms or to screen chemical libraries for compounds that upregulate utrophin posttranscriptionally via its UTRs. Compounds identified via this assay, used alone or in a synergistic combination with utrophin promoter-targeting molecules, would be predicted to have therapeutic potential for DMD.
The process of mRNA localization within a specific cytoplasmic region is an integral aspect of the regulation of gene expression. Furthermore, colocalization of mRNAs and their respective translation products may facilitate the proper assembly of multisubunit complexes like the thick and thin filaments of muscle. This postulate was tested by investigating the cytoplasmic localization of three mRNAs-the ␣-actin, slow troponin C (sTnC), and slow troponin I (sTnI), which encode different polypeptide partners of the thin filament. Using in situ hybridization we showed that all three thin filament mRNAs are localized in the perinuclear cytoplasm of cultured C 2 C 12 muscle cells. Their localization differs from that of the nonmuscle -actin mRNA, which is localized in the peripheral region of both proliferating nondifferentiated myoblasts and the differentiated myocytes. Analysis of the localization signal of the sTnC mRNA showed that a 40-nucleotide-long region of the sTnC mRNA 3 UTR is sufficient to confer the perinuclear localization on a heterologous reporter -Gal mRNA. This localization signal showed tissue specificity and worked only in the differentiated myocytes, but not in the proliferating myoblasts or in HeLa cells. The predicted secondary structure of the localization signal suggests the presence of multiple stem and loop structures in this region of the 3 UTR. Mutations within the stem region of the localization signal, which abolish the base pairing in this region, significantly reduced its perinuclear mRNA localization activity. Using UV-induced photo-cross-linking of RNA and proteins we found that a myotube-specific 42-kDa polypeptide binds to the localization signal.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
customersupport@researchsolutions.com
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.