IMP1 interacts with poly(A)‐binding protein (PABP) and the autoregulatory translational control element of PABP‐mRNA through the KH III‐IV domain

Abstract

Repression of poly(A)‐binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin‐like growth factor II mRNA binding protein‐1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine‐rich autoregulatory sequence (ARS) located at the 5′ untranslated region of the PABP‐mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C‐terminal PABP‐C and K‐homology (KH) III‐IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA‐binding domains, whereas KH III‐IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide‐long CCCAAAAAAAUUUACAAAAAA sequence located at the 3′ end of the ARS. Results of our analysis suggest that both protein·protein and protein·RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

Makorin Ring Zinc Finger Protein 1 (MKRN1), a Novel Poly(A)-binding Protein-interacting Protein, Stimulates Translation in Nerve Cells

“…The ability of MKRN1-short to interact with IMP1 (see supplemental Fig. 4), a PABP-binding protein involved in translational regulation (64), is consistent with this view. Why does dendritic PABP distribution not change after synaptic stimulation?…”

Insulin-Like Growth Factor II mRNA Binding Protein 1 Associates with Gag Protein of Human Immunodeficiency Virus Type 1, and Its Overexpression Affects Virus Assembly

“…It is therefore difficult to predict whether HIV-1 RNA represents a target for IMP1. Nonetheless, this concept is supported by the result of a recent study showing that the IMP1 binding site in the PABP [poly(A) binding protein] mRNA contains the 5Ј-CCCAAAA AAAUUU-3Ј RNA sequence (52). Notably, the 5Ј untranslated region of HIV-1 RNA bears the 5Ј-CGCCAAAAAUU U-3Ј sequence that resembles the core element of the IMP1 binding site in the PABP mRNA.…”

Identification of a Male-Specific RNA Binding Protein That Regulates Sex-Specific Splicing of Bmdsx by Increasing RNA Binding Activity of BmPSI

“…The highly conserved vertebrate homologs contain two copies of RRMs and four copies of KH domains. In some VICKZ proteins, KH domains also support protein-protein interactions, mediating homo-oligomerization or association with other proteins (16,36,49). Likewise, our pulldown assays and mobility shift assays using ⌬KH(3-4) and ⌬KH(1-4) mutants showed that at least the KH1 and KH2 domains are essential for BmIMP interactions with BmPSI and for BmIMP to increase BmPSI-RNA binding activity.…”