We report the first Shiga toxin 2-producing Acinetobacter haemolyticus strain that was isolated from the feces of a 3-month-old infant with bloody diarrhea. Usual enteropathogenic bacteria were not detected. This finding suggests that any Shiga toxin-producing microorganism capable of colonizing the human gut may have the potential to cause illness. CASE REPORTIn November 2001, a 3-month-old male infant was admitted at Pereira Rossell Pediatric Hospital with bloody diarrhea of 12 h evolution without fever or other previous pathologies. The patient was treated empirically with intravenous ceftriaxone and hospitalized for 24 h.Samples of feces were obtained before and after the patient was treated with antibiotics, and they were simultaneously studied at the Microbiology laboratory of the Pereira Rossell Pediatric Hospital and at the Reference laboratory for Shiga toxin-producing Escherichia coli. This last study, done in the context of an institutional program aimed at the regional surveillance of bloody diarrheas and hemolytic-uremic syndrome (HUS) etiology, is the focus of the present article.The presence of Salmonella, Shigella, enteroinvasive E. coli, and enteropathogenic E. coli, Yersinia enterocolitica, and Campylobacter in fecal samples was studied using standard procedures, as previously described (18). The searching of Shiga toxin-producing E. coli (STEC) was done by selective enrichment protocol (9) on Trypticase soy broth (Bacto, Le Pont de Claix, France) with 2.5 mg/liter sodium tellurite and 0.05 mg/liter cefixime (CT-TSB; BioMérieux, Marcy LЈÉtoile, France) and further isolation on MacConkey sorbitol (SMAC) plates (Oxoid, Hampshire, England).The microscopic analysis of the two fecal samples showed a low number of leukocytes (5 to 10 per microscopic field) and did not reveal spiral bacteria that would suggest the presence of Campylobacter spp.The cultures from the first fecal sample developed well in all inoculated media.From the second fecal sample, only 12 colonies (all sorbitol negative) were recovered on a directly inoculated SMAC plate after 48 h of culture. From the enrichment broth, we did not recover any microorganism on the SMAC plate.The microbiological studies did not reveal the presence of usual enteropathogenic bacteria in any of the two samples.Twenty sorbitol-positive colonies plus a lysate from the confluent zone in the SMAC plate of the first sample (nonfermenting colonies were not recovered) and the 12 sorbitolnegative colonies recovered from the second sample were analyzed by PCR, as previously described (13), to detect the presence of Stx1/Stx2-encoding organisms. This PCR was performed with primers VT1A-F (GAAGAGTCCGTGGGATT ACG) and VT1B-R (AGCGATGCAGCTATTAATAA) for stx 1 and with primers VT2A-F (TTAACCACACCCACGGCAGT) and VT2B-R (GCTCTGGATGCATCTCTGGT) for stx 2 .E. coli K-12 C600 E. coli K-12 C600 (F Ϫ thi-1 thr-1 leuB6 lacY1 tonA21 supE44 ⌬ ⌬stx 1 ⌬stx 2 ) and Stx2/Stx1-producing E. coli STEC O157:H7 EDL933 were used as negative and positive controls, respectively, in all PCR as...
Bovine Respiratory Disease is the most costly disease that affects beef and dairy cattle industry. Its etiology is multifactorial, arising from predisposing environmental stress conditions as well as the action of several different respiratory pathogens. This situation has hindered the development of effective control strategies. Although different type of vaccines are available, many currently marketed vaccines are based on inactivated cultures of the main viral and bacterial agents involved in this pathology. The molecular composition of commercial veterinary vaccines is a critical issue. The present work aims to define at the proteomic level the most relevant valence of a line of commercial respiratory vaccines widely used in Central and South America. Since Mannheimia haemolytica is responsible for most of the disease associated morbid-mortality, we focused on the main proteins secreted by this pathogen, in particular Leukotoxin A, its main virulence factor. By Western blot analysis and mass spectrometry, Leukotoxin A was identified as a major component of M. haemolytica culture supernatants. We also identified other ten M. haemolytica proteins, including outer membrane proteins, periplasmic transmembrane solute transporters and iron binding proteins, which are relevant to achieve protective immunity against the pathogen. This work allowed a detailed molecular characterization of this vaccine component, providing evidence of its quality and efficacy. Furthermore, our results contributed to the identification of several proteins of interest as subunit vaccine candidates.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.