In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5′-TGGATCTCACTGGTTGCTTG-3′)-ToCVp22RQR (5′-TAGTGTTTCAGCGCCAACAG-3′) primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5′-CATTGGTTGGGGATTACGTC-3′)-ToCVCPmRQR (5′-TCTCAGCCTTGACTTGAGCA-3′) primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) A. Solorzano-Morales et al. Plant Dis. 95:497, 2011. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008. (4) S. Wyatt and J. Brown. Phytopathology 86:1288, 1996.
In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.
One hundred and thirty one strains of R. leguminosarum bv phaseoli were isolated from different bean producing zones in Costa Rica. The response of its inoculation to the Huasteco Negro (Phaseolus vulgaris L.) bean variety was evaluated under green house conditions. Pots and heat treated soil were used. The seeds inoculation was conducted using a bacterial suspension of 10° ucf/ml, approximately. Besides, anabsolute control (without inoculation, without nitrogen) and a control with nitrogen (+ 140 kg N/ha) were included. The dry weight of the nodules, dry weight of the aerial part and the ureids concentration of the foliar area at the R6 stage ofdevelopment were the measured variables. The plants inoculated with the CR-455, CR-487 and CR-BSA strains showed the largest nodules’ dry weight values. The absolute control showed the lowest dry weight of nodules. Significant differences (P<0.05) were observed among so me treatments and the controls. The plants showing the highest foliar dry weight were those inoculated with the CR-482, CR-492, CR- 422 and CR-454 strains. Significant differences (P<0.05) were registered for the ureids concentrations among some treatments and the controls. The plants inoculated with the CR-475, CR- 492 and CR-422, CR-487 and CR-477 strains had the highest ureids concentrations and also showed the largest atmospheric nitrogen fixing capacity under green house conditions. A variation of the atmospheric nitrogen fixing capacity or effectiveness among some Rhizobium strains was observed, when comparing the results with the absolute and nitrogenous controls, which agrees with the bibliography.
In animal-pollinated plants, two factors affecting pollen flow and seed production are changes in floral display and the availability of compatible mates. Changes in floral display may affect the number of pollinator visits and the availability of compatible mates will affect the probability of legitimate pollination and seed production. Distyly is a floral polymorphism where long-styled (pin) and short-styled (thrum) floral morphs occur among different individuals. Distylous plants frequently exhibit self and intra-morph incompatibility. Therefore changes in morph abundance directly affect the arrival of compatible pollen to the stigmas. Floral morph by itself may also affect female reproductive success because floral morphs may display differences in seed production. We explored the effects of floral display, availability of neighboring compatible mates, and floral morph on seed production in the distylous herb ARCYTOPHYLLUM LAVARUM. We found that floral display does not affect the mean number of seeds produced per flower. There is also no effect of the proportion of neighboring legitimate pollen donors on seed production in pin or thrum flowers. However, floral morphs differed in their female reproductive success and the thrum morph produced more seeds. Hand pollination experiments suggest that differences in seed production between morphs are the result of pollen limitation. Future research will elucidate if the higher seed production in thrum flowers is a consequence of higher availability of pollen donors in the population, or higher efficiency of the pin morph as pollen donor.
Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1) was obtained from a chayote (S. edule) leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV) and Pepper golden mosaic virus (PepGMV) were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV) infecting chayote in the Western Hemisphere.
With the objective of evaluating, in the field, the antagonism of Rhizobium leguminosarum biovar phaseoli against Rhizoctonia solani, two experiments were established in the zones of Santa Rosa de Pocosol (Alajuela) and Sabanilla de Montes de Oca (San José), in two different sowing seasons. The stocks CR- 455, CR-477, CR-487, CR-422 and CIAT-632, were evaluated and were inoculated with R. solani. Besides the stocks we included the following treatments: Absolute Witness (AW), with no R. solani inoculation, with no nitrogen added(-N, -R); +N-R (+140 kg N/ha, with no R. solani inoculation); +N+R (+140 kg N&ha, with R. solani inoculated). The soil was inoculated utilizing rice husks colonized by R. solani, at a dosis of 14,5 g/m2.. We evaluated the variables: porcent of germination, plants height and infection rate. We performed the evaluations at 8 and 18 days after germination. We utilized the design of complete blocks ramdomly located with six repetitions per treatment. The variable of plant height did not show any differences between treatments in any of the zones. The treatment with fungicides was the one which showed more germination percentages in both experiments. In Pocosol, all the stocks sho wed some inhibition effect towards the fungus (P<0.05), but only during the period of the first evaluation. In Montes de Oca, we observed a larger inhibiton effect thant the one in Santa Rosa; the stocks CR-487 and CR- 422 showed smaller I.I than the witness in the first evaluation (P<0,05), and they all showd significant differences on what concerns the +N+R treatment for the same variable, during the second evaluation.
In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.
The objective of this study was to select sources of resistance to angular leaf spot and anthracnose from a diverse group of germplasm with known resistance to these diseases and other abiotic and biotic factors. Atotal of 173 common beans that included 46 landraces and 127 breeding lines were evaluated at two locations (Estación Experimental Fabio Baudrit Moreno and Sub-Estación Experimental Fraijanes, both of Universidad de Costa Rica) in 1996 and 1997. A mixture of four races (races 9, 10, 547, and 1024 of maximum virulence and coverage in Costa Rica) of the anthracnose pathogen was used to inoculate four times. Because of high natural incidence of angular leaf spot, inoculation was not necessary. Twenty-one landraces and 13 breeding lines were resistant (disease score of 3 or less) to antracnose. Only five landraces (G 12529, G 14934, G 19428, G 19696, and G 19831), one improved cultivar (ICA Tundama), and a breeding line UCR 55 had intermediate reaction (disease score between 4 and 6). Thus, for angular leaf spot evaluation of a much broader range of germplasm of common bean and other related species is suggested.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.