BackgroundDeveloping new population types based on interspecific introgressions has been suggested by several authors to facilitate the discovery of novel allelic sources for traits of agronomic importance. Chromosome segment substitution lines from interspecific crosses represent a powerful and useful genetic resource for QTL detection and breeding programs.ResultsWe built a set of 64 chromosome segment substitution lines carrying contiguous chromosomal segments of African rice Oryza glaberrima MG12 (acc. IRGC103544) in the genetic background of Oryza sativa ssp. tropical japonica (cv. Caiapó). Well-distributed simple-sequence repeats markers were used to characterize the introgression events. Average size of the substituted chromosomal segments in the substitution lines was about 10 cM and covered the whole donor genome, except for small regions on chromosome 2 and 4. Proportions of recurrent and donor genome in the substitution lines were 87.59% and 7.64%, respectively. The remaining 4.78% corresponded to heterozygotes and missing data. Strong segregation distortion was found on chromosomes 3 and 6, indicating the presence of interspecific sterility genes. To illustrate the advantages and the power of quantitative trait loci (QTL) detection using substitution lines, a QTL detection was performed for scored traits. Transgressive segregation was observed for several traits measured in the population. Fourteen QTLs for plant height, tiller number per plant, panicle length, sterility percentage, 1000-grain weight and grain yield were located on chromosomes 1, 3, 4, 6 and 9. Furthermore, a highly significant QTL controlling resistance to the Rice stripe necrosis virus was located between SSR markers RM202-RM26406 (44.5-44.8 cM) on chromosome 11.ConclusionsDevelopment and phenotyping of CSSL libraries with entire genome coverage represents a useful strategy for QTL discovery. Mapping of the RSNV locus represents the first identification of a genetic factor underlying resistance to this virus. This population is a powerful breeding tool. It also helps in overcoming hybrid sterility barriers between species of rice.
Regional seismic reflection profiles and well data from the Uruguayan margin were integrated in order to analyse and illustrate its tectonic and stratigraphic evolution. The evolution of the Punta del Este and Pelotas basins is divided into four major phases: pre-rift (Palaeozoic); rift (Jurassic–Early Cretaceous); transition (Barremian–Aptian) and post-rift (Aptian–Present). Each of these phases is characterized by a specific structural configuration and a stratigraphic architecture related to basin type, tectonic elements, sediment supply and base-level changes. During the geological evolution of the Uruguayan continental margin, a NE migration of depocentres occurred. The Cretaceous depocentre is located in the Punta del Este Basin, while the Cenozoic depocentre is located in the Pelotas Basin.
Resumo A Bacia de Santos foi formada a partir de processos de rifteamento durante a separação afroamericana, no Mesozóico. A acumulação de sedimentos ocorreu inicialmente em condições flúvio-lacustres, passando posteriormente por estágio de bacia evaporítica e evoluindo para uma bacia de margem passiva. A análise do potencial do sistema petrolífero da bacia possibilitou identificar dois sistemas petrolíferos: Guaratiba-Guarujá e Itajaí-Açu-Ilhabela. A Formação Guaratiba, principal geradora, ainda é pouco conhecida na bacia devido à existência de poucos poços. Por analogia à congênere e vizinha Bacia de Campos, os óleos de origem salina foram gerados a partir de rochas depositadas em ambiente lacustre salino durante o Aptiano. Tal analogia foi confirmada pelas análises de amostras de óleo de alguns poços. Nestas análises também foi identificada a contribuição de óleo de origem marinha, indicando que a rocha geradora Itajaí-Açu (Cenomaniano-Turoniano) está na janela de geração, especialmente nos baixos estruturais gerados pela halocinese. Os modelos de acumulação consideram Formação. Guaratiba como o principal gerador de hidrocarbonetos para reservatórios calcareníticos plataformais da Formação Guarujá e turbiditos (desde Albiano Superior até o Mioceno), bem como siliciclásticos e carbonáticos da fase rifte. A migração ocorre através de falhas, janelas de sal e carrierbeds. O selo é formado por folhelhos e calcilutitos intraformacionais, além da espessa camada de evaporitos que pode contribuir como selo para a seção rifte, especialmente em águas profundas. A grande espessura das seções do Cretáceo Médio e Superior é responsável pela sobrecarga, contribuindo significativamente para a geração e expulsão de hidrocarbonetos neste período. As trapas são do tipo estruturais (rollovers e casca-detartaruga), estratigráficas (pinch-outs de corpos arenosos) e mistas (pinch-outs de turbiditos contra a parede de domos salinos).
Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.