Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama

Abstract

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Burkholderia glumae and B. gladioli Cause Bacterial Panicle Blight in Rice in the Southern United States

“…Although rice grain rot, caused by B. glumae (formerly Pseudomonas glumae), was initially considered a serious pathogen only in Japan, it is now reported in several major rice growing countries of the world including Korea (10), Taiwan (2), Latin America (21,40), Vietnam (33), the Philippines (3), and the Gulf of Mexico rice production area in the United States (20,22,27,30). The pathogen was reported in 2007 from symptomless seeds in China, where the isolated strain caused disease in inoculated rice plants (17).…”

“…More recently, real-time PCR assays have been used for rapid, accurate, and sensitive identification and quantification of pathogens from infected plant tissues (15,16,24,29). PCR and real-time PCR have been used as the main methods for identifying several Burkholderia species from soil, water, infected plants, and mammalian cells (5,18,21,22,27,32). In our study, we screened all of the rice strains with B. glumae-specific primers and then screened B. glumae-negative strains with B. gladioli-, B. plantarii-, and B. multivorans-specific primers.…”

Identification of qRBS1, a QTL involved in resistance to bacterial seedling rot in rice

“…The infection reduces yield owing to spikelet abortion, and infected seeds cause BSR and grain rot in the next generation (Ham et al 2011b). BSR and bacterial grain rot have been widespread in Japan (Goto and Ohata 1956; Goto et al 1987; Kurita and Tabei 1967; Uematsu et al 1976a), East Asia (Azegami 2009; Chien and Chang 1987; Cottyn et al 1996a, b; Jeong et al 2003; Luo et al 2007; Trung et al 1993) and Latin America (Nandakumar et al 2007b; Zeigler and Alvarez 1989). Therefore, it is necessary to breed cultivars, which are resistant to both BSR and bacterial grain rot.…”

“…Since disease caused by B. glumae was first discovered in Japan (Goto and Ohata 1956; Goto et al 1987; Kurita and Tabei 1967; Uematsu et al 1976a), it has also been reported in other countries in East Asia (Azegami 2009; Chien and Chang 1987; Cottyn et al 1996a; Cottyn et al 1996b; Jeong et al 2003; Luo et al 2007; Trung et al 1993) and Latin America (Nandakumar et al 2007b; Zeigler and Alvarez 1989). In the USA, B. glumae has been identified as the major causal agent of bacterial grain rot (Nandakumar et al 2005, 2009; Shahjahan et al 2000).…”

Understanding the direction of evolution in Burkholderia glumae through comparative genomics

“…As a phytopathogen, plant-associated Burkholderia spp. are very important because they cause heavy damage and rapidly spread to many countries (Ura et al 2006;Nandakumar et al 2007Nandakumar et al , 2009Riera-Ruiz et al 2014). For example, B. plantarii causes seedling blight in rice through its phytotoxin tropolone (Urakami et al 1994).…”