Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

Background: Ustekinumab is an effective therapy for Crohn disease currently approved for adults. Off-label use in the pediatric population is increasing, but its effectiveness in this age group has not been reported. Aims: The aim of the study was to describe real-world experience with ustekinumab at a tertiary care pediatric inflammatory bowel disease (IBD) center. Methods: As part of an ongoing observational cohort study of biologic-treated pediatric IBD patients initiated in October 2014, data on demographics, disease behavior, location and activity, treatment, and surgical history were collected for all patients receiving ustekinumab. Disease activity was assessed using the Harvey Bradshaw index or partial Mayo score. Primary outcome was steroid-free remission at 52 weeks. Descriptive statistics summarized the safety and efficacy outcomes, and univariate analyses were performed to examine associations of clinical characteristics with efficacy. Results: Fifty-two children and young adults initiating ustekinumab were analyzed; 81% Crohn Disease, 8% ulcerative colitis, and 11% IBD-unspecified. Median [IQR] age at induction was 16.8 [14–18] years. Patients were followed for a minimum of 12 months. Most patients (81%) failed >1 anti-TNF, and 37% failed anti-TNF and vedolizumab; 10 patients were biologic-naïve. At week 52, 75% were still on ustekinumab, and 50% (bio-exposed) and 90% (bio-naïve) were in steroid-free remission. Two infusion reactions and neither serious adverse events nor serious infections were observed. Conclusions: Our results suggest that ustekinumab is efficacious and safe in pediatric patients with IBD. Controlled clinical trial data are needed to confirm these observations.

Background Oral exposure to food allergens may be limited in infancy and the initial site of antigen exposure likely plays an important role in food allergy induction. Objective To examine the impact of different routes of exposure using milk allergens, with and without adjuvant, on sensitization. Methods C3H/HeJ mice were repeatedly exposed to the milk allergen α-lactalbumin (ALA), with or without cholera toxin (CT). Sensitization routes used were intragastric, cutaneous, intranasal, and sublingual. Anaphylaxis severity was assessed by symptoms and body temperature in response to oral or systemic challenge. Antigen-specific serum antibodies were measured by ELISA. The mechanism of adjuvant activity of cutaneous CT was also determined. Results Sensitization to ALA as measured by allergen-specific IgE occurred by all routes of sensitization, and was maximal in response to cutaneous exposure. Sensitization was dependent on CT and did not occur to antigen alone by any route. Mucosal, but not cutaneous exposure, resulted in a robust allergen-specific IgA response. Anaphylaxis occurred in all sensitized groups when orally challenged with ALA. Topical CT induced migration of langerinneg dermal DCs to the lymph node, resulting in enhanced proliferation and Th2 cytokine production from responder T cells. Conclusions Sensitization can occur via all physiologic routes when adjuvant is present. The skin is a potent and likely important physiologic route of sensitization whereby adjuvant induces an efflux of antigen-bearing dermal DCs to the lymph node that generate a pro-allergic Th2 response.

The skin immune system must discriminate between innocuous antigens and pathogens. Antigen applied topically using a Viaskin® patch elicits immune tolerance that can suppress colitis and food allergy. Here we show how topical antigen is acquired and presented by dendritic cells in the skin. Topical antigen is acquired by Langerhans cells (LC) and CD11b+ cDC2s but not cDC1s, and both  LCs and CD11b+ cDC2s reaching the lymph node can prime T cells and expand LAP+ Tregs. However, LCs are neither required nor sufficient for T cell priming, and have no role in tolerance induction. Conversely, IRF-4-dependent cDC2s are required for T cell priming. Acquisition of antigen in the dermis, delivery to the draining lymph node, and generation of tolerance are all absent in hairless mice. These results indicate an important function for hair follicle niche and CD11b+ cDC2s in antigen acquisition, and in generation of primary immune tolerance to topical antigens.

Autoinflammatory disease can result from monogenic errors of immunity. We describe a patient with early-onset multi-organ immune dysregulation resulting from a mosaic, gain-of-function mutation (S703I) in JAK1 , encoding a kinase essential for signaling downstream of >25 cytokines. By custom single-cell RNA sequencing, we examine mosaicism with single-cell resolution. We find that JAK1 transcription was predominantly restricted to a single allele across different cells, introducing the concept of a mutational “transcriptotype” that differs from the genotype. Functionally, the mutation increases JAK1 activity and transactivates partnering JAKs, independent of its catalytic domain. S703I JAK1 is not only hypermorphic for cytokine signaling but also neomorphic, as it enables signaling cascades not canonically mediated by JAK1. Given these results, the patient was treated with tofacitinib, a JAK inhibitor, leading to the rapid resolution of clinical disease. These findings offer a platform for personalized medicine with the concurrent discovery of fundamental biological principles.