Members of our group recently identified a new tetracycline resistance gene, tet(W), in three genera of rumen obligate anaerobes. Here, we show that tet(W) is also present in bacteria isolated from human feces. The tet(W) genes found in human Fusobacterium prausnitzii and Bifidobacterium longum isolates were more than 99.9% identical to those from a rumen isolate of Butyrivibrio fibrisolvens.The rapid increase in antibiotic resistance in human pathogenic bacteria is a major problem, particularly for nosocomial infections (5). In the past, antibiotic resistance genes have primarily been described either in clinical pathogens or in antibiotic-producing microorganisms, and comparatively little work has been done on the incidence of antibiotic resistance in the commensal gut flora, either of humans or of animals. A new ribosome-protection-type tetracycline resistance (Tc r ) gene, tet(W), (GenBank accession no. AJ222769), was recently identified in the rumen anaerobe Butyrivibrio fibrisolvens and was also found in rumen isolates of Selenomonas spp. and Mitsuokella spp. and in one Mitsuokella isolate from a Japanese pig (1). The high degree of homology between all of these tet(W) genes suggested that recent gene transfer events had resulted in the spread of the gene. tet(W) was shown to be chromosomally located in B. fibrisolvens and to transfer at frequencies of 10 Ϫ3 to 10 Ϫ5 per recipient between genotypically diverse B. fibrisolvens strains in vitro (10). The translated product of tet(W) shares only 68% amino acid homology with Tet(O) and Tet(M) proteins (1). Here, we describe for the first time the identification of tet(W) in anaerobic bacteria recovered from human feces.Human fecal samples were resuspended in anaerobic 0.1 M sodium phosphate buffer (pH 7.2), and dilutions were plated out anaerobically either on M2GCS agar plates (6) containing 5 or 10 g of tetracycline per ml or in M2GCS roll tubes (2) containing 10 g of tetracycline per ml. Plates were inoculated in an anaerobic cabinet (55% CO 2 , 40% N 2 , and 5% H 2 ; Coy Laboratory Products Inc., Grass Lake, Mich.), and roll tubes were prepared under 100% CO 2 (2). Cultures were incubated at 37°C.For one sample from a middle-aged male receiving daily tetracycline treatment over a 10-year period, more than 99% of the 8.3 ϫ 10 10 colonies growing anaerobically were Tc r . Random colonies were picked from roll tubes and regrown in the presence of 10 g of tetracycline per ml. Total genomic DNA was purified (10) and amplified by PCR, either using degenerate primers which identify all ribosome-protection-type Tc r genes (1) or using a primer combination specific for tet(W) (tetW for [5Ј AAGCGGCAGTCACTTCCTTCC 3Ј] and tet2 [see reference 1]). All 14 of the colonies tested yielded a product with the degenerate Tc r primer set, while only one, isolate K10, yielded a product with primers specific for tet(W). Culturing of two additional samples from 25-year-old individuals who had not taken antibiotics for at least 10 years showed that less than 0.01% of the total ana...

A novel tetracycline resistance gene, designated tet(32), which confers a high level of tetracycline resistance, was identified in the Clostridium-related human colonic anaerobe K10, which also carries tet(W). tet(32) was transmissible in vitro to the rumen anaerobe Butyrivibrio fibrisolvens 2221 R . The predicted gene product of tet(32) has 76% amino acid identity with Tet(O). PCR amplification indicated that tet(32) is widely distributed in the ovine rumen and in porcine feces.

The Butyrivibrio fibrisolvens tet(W) gene is located on the conjugative transposon TnB1230. TnB1230 encodes transfer proteins with 48 to 67% identity to some of those encoded by Tn1549. tet(W) is flanked by directly repeated sequences with significant homology to oxygen-insensitive nitroreductases. The 340 nucleotides upstream of tet(W) are strongly conserved and are required for tetracycline resistance.Tetracyclines are the second most widely used group of antibiotics worldwide, and tetracycline resistance (Tc r ) is extremely common among bacteria (17). Many Tc r genes are transmissible, being carried by plasmids or transposable chromosomal elements. Tc r genes have mainly been described for pathogenic bacteria, but the new resistance genes tet(W) (2, 20) and tet(32) (12) were first identified in anaerobic commensal bacteria from the rumen and from porcine and human feces. These genes are distinct from previously described ribosome protection genes, with the highest identities being 68% [to Tet(W)] and 76% [to Tet(32)] at the corresponding amino acid level. tet(W) is one of the most widespread tetracycline resistance genes in environmental samples (1,23).Copies of tet(W) found in environmentally and phylogenetically distinct bacterial isolates (2, 20) have remarkable sequence conservation, which argues for the extensive rapid transfer of this gene in nature. Previous work showed that tet(W) could be transferred at high frequencies (10 Ϫ2 to 10 Ϫ5

Transformation of Streptococcus gordonii DL1 by free DNA was studied in human saliva. Competent S. gordonii could be transformed in vitro with plasmid DNA that had been taken into the human mouth. Transformation also occurred with a plasmid that cannot replicate in S. gordonii, but that has a region of chromosomal homology, by integration into the bacterial chromosome, although linearised plasmid DNA gave no transformants. Linear chromosomal DNA fragments did however transform S. gordonii/Tn916 efficiently in saliva when regions of homology with the recipient chromosome flanked the marker gene. These findings are discussed in relation to the potential for acquisition of DNA sequences, including genetically modified DNA, by gut and oral bacteria.

Several pieces of evidence implicate serotonin receptors in the aetiology of schizophrenia, and recently a number of studies have reported a genetic association between the 102T/C polymorphism of serotonin receptor type 2A gene and schizophrenia. Unfortunately a number of failures to replicate these positive associations in both Caucasian and Chinese populations have also been reported. We have examined the 102T/C polymorphism by PCR amplification and restriction analysis of DNA from: 202 schizophrenics and 202 controls from Shanghai; 112 schizophrenics and 224 parents from Chengdu, Cina; and 253 schizophrenics and 244 controls from the the UK. We find no evidence of association or transmission disequilibrium between the 102T/C polymorphism and schizophrenia in any of the groups we have examined. We conclude that either the original positive reports occurred by chance or any effect must be minimal, and urge caution in interpreting small positive results derived using data from different centres.

Natural transformation of Streptococcus bovis JB1 was demonstrated after development of competence in normal culture medium. Transformation efficiencies were not significantly increased when heat-inactivated horse serum was added to the medium before growth. This is the first time that a resident rumen bacterial species has been shown to be naturally transformable. Transformation allowed the acquisition of plasmids or integration of sequences into the chromosome. No transformation was observed in the presence of undiluted autoclaved or filter-sterilised ovine rumen fluid or filter-sterilised ovine saliva, suggesting that transformation in the ruminant digestive tract is a rare event, although transformation was observed in the presence of 1% and 0.5% filter-sterilised rumen fluid. The use of natural transformation of S. bovis should facilitate further molecular biological studies on this species.

An integration vector was constructed to allow introduction of the gfp gene into the chromosomes of Gram-positive bacteria. Integration depends on homologous recombination between a short 458-nt sequence of the tet(M) gene in the vector and a copy of Tn916 in the host chromosome. Strains of Lactococcus lactis IL1403, Enterococcus faecalis JH2-SS, and Streptococcus gordonii DL1 stably marked with single chromosomal copies of the gfp were readily visualised by epifluorescence microscopy. The marked L. lactis strain survived poorly in a continuous culture system inoculated with human faecal flora, while the laboratory E. faecalis strain was lost at approximately the dilution rate of the fermenter.

Extended abstract of a paper presented at Microscopy and Microanalysis 2013 in Indianapolis, Indiana, USA, August 4 – August 8, 2013.