Occurrence of the New Tetracycline Resistance Gene tet (W) in Bacteria from the Human Gut

Abstract

Members of our group recently identified a new tetracycline resistance gene, tet(W), in three genera of rumen obligate anaerobes. Here, we show that tet(W) is also present in bacteria isolated from human feces. The tet(W) genes found in human Fusobacterium prausnitzii and Bifidobacterium longum isolates were more than 99.9% identical to those from a rumen isolate of Butyrivibrio fibrisolvens.The rapid increase in antibiotic resistance in human pathogenic bacteria is a major problem, particularly for nosocomial infections (5). In the past, antibiotic resistance genes have primarily been described either in clinical pathogens or in antibiotic-producing microorganisms, and comparatively little work has been done on the incidence of antibiotic resistance in the commensal gut flora, either of humans or of animals. A new ribosome-protection-type tetracycline resistance (Tc r ) gene, tet(W), (GenBank accession no. AJ222769), was recently identified in the rumen anaerobe Butyrivibrio fibrisolvens and was also found in rumen isolates of Selenomonas spp. and Mitsuokella spp. and in one Mitsuokella isolate from a Japanese pig (1). The high degree of homology between all of these tet(W) genes suggested that recent gene transfer events had resulted in the spread of the gene. tet(W) was shown to be chromosomally located in B. fibrisolvens and to transfer at frequencies of 10 Ϫ3 to 10 Ϫ5 per recipient between genotypically diverse B. fibrisolvens strains in vitro (10). The translated product of tet(W) shares only 68% amino acid homology with Tet(O) and Tet(M) proteins (1). Here, we describe for the first time the identification of tet(W) in anaerobic bacteria recovered from human feces.Human fecal samples were resuspended in anaerobic 0.1 M sodium phosphate buffer (pH 7.2), and dilutions were plated out anaerobically either on M2GCS agar plates (6) containing 5 or 10 g of tetracycline per ml or in M2GCS roll tubes (2) containing 10 g of tetracycline per ml. Plates were inoculated in an anaerobic cabinet (55% CO 2 , 40% N 2 , and 5% H 2 ; Coy Laboratory Products Inc., Grass Lake, Mich.), and roll tubes were prepared under 100% CO 2 (2). Cultures were incubated at 37°C.For one sample from a middle-aged male receiving daily tetracycline treatment over a 10-year period, more than 99% of the 8.3 ϫ 10 10 colonies growing anaerobically were Tc r . Random colonies were picked from roll tubes and regrown in the presence of 10 g of tetracycline per ml. Total genomic DNA was purified (10) and amplified by PCR, either using degenerate primers which identify all ribosome-protection-type Tc r genes (1) or using a primer combination specific for tet(W) (tetW for [5Ј AAGCGGCAGTCACTTCCTTCC 3Ј] and tet2 [see reference 1]). All 14 of the colonies tested yielded a product with the degenerate Tc r primer set, while only one, isolate K10, yielded a product with primers specific for tet(W). Culturing of two additional samples from 25-year-old individuals who had not taken antibiotics for at least 10 years showed that less than 0.01% of the total ana...

Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance

“…The different tet genes can have either the same mode of action (efflux or ribosomal protection), or different modes of action (efflux and ribosomal protection), just like the pathogenic and opportunistic species do (230). The carriage of multiple tet genes of different classes is commonly found in individual gram-positive isolates (37,236,266,267,307) and in Mycobacterium spp. and Streptomyces spp.…”

“…Based on information from references 8, 9, 11, 14, 19, 40, 45, 55, 58-61, 81, 94, 97, 104, 111, 115, 116, 120, 122, 132, 139, 143, 149, 151, 152, 155, 163, 168-170, 182, 189, 200, 201, 206, 224, 227, 232, 233, 234, 241, 248, 256, 262, 267, 280, 282, 296, 314, 317 (14,150,267).…”

Presence of tetracycline resistant bacteria and genes in grassland-based animal production systems

“…While it is not possible to determine the origin of resistance on the evaluated farms using molecular techniques, it can be determined whether there is resistant gene flow from one compartment to another (animal/environment). The method for tracking the flow of a gene based on nucleotide sequence similarity has been widely applied, as shown in studies by Jansen et al (1998), Scott et al (2000) and Aminov et al (2001). The sequence similarity among resistance genes detected in animal and environmental samples in this study, despite the fact the two compartments host different microbial communities (Figure 3), provides evidence of horizontal transfer through mobile genetic elements between these two compartments.…”

Genetically modified organisms: consequences for ruminant health and nutrition

“…TetW genes found in isolates from three rumen genera, Butyrivibrio, Selenomonas and Mitsuokella share more than 99% base sequence identity, arguing for very rapid recent genetic exchange between them [2]. TetW genes have now been found in anaerobic bacteria from pigs and humans and again show remarkable sequence similarity to the original ruminal isolate [72]. The tetW product shows only 68% amino acid sequence homology with its closest relatives (tetM and tetO) among the products of ribosome protection type resistance genes [2].…”