In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3′-terminal under the bottom G-quartet. The 3′-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

An NMR structural study of the interaction between a small-molecule optical probe (DAOTA-M2) and a G-quadruplex from the promoter region of c-myc oncogene demonstrates their interaction at 1:2 binding stoichiometry. NMR restrained structural calculations show that binding of DAOTA-M2 occurs mainly through the π-π stacking between the polyaromatic core of the ligand and guanine residues of the outer G-quartets.Interestingly, the binding affinities of DAOTA-M2 to the outer G-quartets of the unimolecular parallel G-quadruplex under study differ by a factor of two. Unrestrained MD calculations indicate that DAOTA-M2 displays significant dynamic behavior when stacked on a G-quartet plane. These studies provide molecular guidelines for design of triangulenium derivatives that can be used as optical probes of G-quadruplexes.

EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents an important target for anticancer therapy. Indeed, several human cancers showed an upregulation of the activity of this protein. The promoter of this gene contains some G-rich domains, thus representing a yet unexplored point of intervention to potentially silence this gene. Here, we explore the conformational equilibria of a 30-nt long sequence located at position −272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on the wild-type sequence as well as on a wide panel of related mutants, we were able to prove that in potassium ion containing solution this sequence folds into two main G-quadruplex structures, one parallel and one hybrid. They show comparable thermal stabilities and affinities for the metal ion and, indeed, they are always co-present in solution. The folding process is driven by a hairpin occurring in the domain corresponding to the terminal loop which works as an important stabilizing element for both the identified G-quadruplex arrangements.

Ligands that bind to and stabilize guaninequadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topologydependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

No abstract