Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure

Abstract

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3′-terminal under the bottom G-quartet. The 3′-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

The Potential of Telomeric G-Quadruplexes Containing Modified Oligoguanosine Overhangs in Activation of Bacterial Phagocytosis and Leukotriene Synthesis in Human Neutrophils

“…According to literature data, the addition of different nucleosides at the end of telomere DNA sequence is essential for the formation of different G-quadruplex structures [71]. Slow conversion of kinetically favored antiparallel G-quadruplex into thermodynamically favored parallel one was shown for the G-rich promoter region of c-KIT proto-oncogene [72].…”

Duplex‐Guided Refolding into Novel G‐Quadruplex (3+1) Hybrid Conformations

“…[24] Similarly,p refolding into ahomodimeric structure through base pairing of the short 3'tails of ak it* sequence has recently been suggested to drive folding into as ingle G-quadruplex. [25] In addition to base pairing between overhang sequences, internal hairpin duplexes formed along quadruplex loops have been shown to stabilize quadruplex architectures and seem to be am ore recurrent motif in genomic DNA. [26][27][28] Likewise,t he here reported two novel three-layered (3+ +1) hybrid quadruplexes with one lateral and two propeller loops may be conceivable in G-rich genomic sequences if short single-stranded regions flanking the two outermost functional G-tracts allow for Watson-Crick base pairing.A sd emonstrated by previous studies,t he duplex-quadruplex junction formed may also be au nique interaction site for various ligands.…”

“…It might therefore be speculated that fast transient base pairing of the overhang domains preorganizes the sequence to fold into a hybrid topology with the duplex serving as a kinetic trap . Similarly, prefolding into a homodimeric structure through base pairing of the short 3′‐tails of a kit* sequence has recently been suggested to drive folding into a single G‐quadruplex …”

“…On the other hand, melting of the duplex extension for the two (3+ +1) hybrid structures is indicated by asecond low-temperature melting process about 20 8 8Cbelow the melting point of the quadruplex core.Y et, the additional formation of base pairs between the short overhang sequences allows for the disfavored fold to effectively compete with the parallel topology.I tm ight therefore be speculated that fast transient base pairing of the overhang domains preorganizes the sequence to fold into ah ybrid topology with the duplex serving as ak inetic trap. [25] In addition to base pairing between overhang sequences, internal hairpin duplexes formed along quadruplex loops have been shown to stabilize quadruplex architectures and seem to be am ore recurrent motif in genomic DNA. [25] In addition to base pairing between overhang sequences, internal hairpin duplexes formed along quadruplex loops have been shown to stabilize quadruplex architectures and seem to be am ore recurrent motif in genomic DNA.…”

Duplex‐gesteuerte Umfaltung in neuartige G‐Quadruplex‐(3+1)‐ Hybridkonformationen

“…[24] In ähnlicher Weise wurde kürzlich vermutet, dass fürd ie definierte Faltung einer kit*-Sequenz in eine einzelne Quadruplexstruktur eine durch Basenpaarungen des kurzen 3'-Endes anfangs gebildete,h omodimere Struktur verantwortlich ist. [25] Außer Basenpaarungen zwischen Überhangsequenzen stabilisieren auch Hairpin-Duplexstrukturen innerhalb der Quadruplex-Loopregionen die G4-Struktur und scheinen zudem häufig in genomischer DNAaufzutreten. [26][27][28] Ebenso wäre die Bildung der beiden neuen, hier beschriebenen dreilagigen (3+ +1)-Hybridquadruplexe mit einem Lateralund zwei Propellerloops in G-reichen genomischen Sequenzen denkbar,w enn die äußeren G-Trakte von komplementären, zu Watson-Crick-Basenpaarungen befähigten, einzelsträngigen Sequenzen flankiert würden.…”