NMR Structure of a Triangulenium‐Based Long‐Lived Fluorescence Probe Bound to a G‐Quadruplex

Kotar, Anita; Wang, Baifan; Shivalingam, Arun; González‐García, Jorge; Vilar, Ramón; Plavec, Janez

doi:10.1002/anie.201606877

Cited by 60 publications

(52 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Structural data of G-quadruplex-ligand complexes has been playing an important role in the understanding of small molecule recognition of G-quadruplexes and the design of G-quadruplex-ligands [18,237]. This includes a handful NMR solution structures of intramolecular G-quadruplex-ligand complexes, including c-MYC G-quadruplex-ligand complexes [235,[238][239][240] and telomeric G-quadruplex-ligand complexes [236,[241][242][243], and X-ray crystallographic structures of intramolecular and intermolecular telomeric G-quadruplex-ligand complexes [43,237,[244][245][246][247][248][249][250].…”

Section: G-quadruplex-interactive Small Moleculesmentioning

confidence: 99%

G-Quadruplex DNA and RNA

Yang

2019

Methods in Molecular Biology

View full text Add to dashboard Cite

G-quadruplexes (G4s) have become one of the most exciting nucleic acid secondary structures. A noncanonical, four-stranded structure formed in guanine-rich DNA and RNA sequences, G-quadruplexes can readily form under physiologically relevant conditions and are globularly folded structures. DNA is widely recognized as a double-helical structure essential in genetic information storage. However, only~3% of the human genome is expressed in protein; RNA and DNA may form noncanonical secondary structures that are functionally important. G-quadruplexes are one such example which have gained considerable attention for their formation and regulatory roles in biologically significant regions, such as human telomeres, oncogene-promoter regions, replication initiation sites, and 5 0 -and 3 0 -untranslated region (UTR) of mRNA. They are shown to be a regulatory motif in a number of critical cellular processes including gene transcription, translation, replication, and genomic stability. G-quadruplexes are also found in nonhuman genomes, particularly those of human pathogens. Therefore, G-quadruplexes have emerged as a new class of molecular targets for drug development. In addition, there is considerable interest in the use of G-quadruplexes for biomaterials, biosensors, and biocatalysts. The First International Meeting on Quadruplex DNA was held in 2007, and the G-quadruplex field has been growing dramatically over the last decade. The methods used to study G-quadruplexes have been essential to the rapid progress in our understanding of this exciting nucleic acid secondary structure. G-quadruplexes have been found to form in specific human guanine-rich sequences with functional significance, such as telomeres, oncogene-promoter regions, and 5 0 -and 3 0 -untranslated region (UTR) of mRNA, as well as in nonhuman genomes. G-Quadruplexes in TelomeresThe first biologically relevant G-quadruplex was observed in telomeric DNA. Telomeres are specific DNA-protein complexes at the ends of linear chromosomes, providing protection against gene erosion from cell divisions, chromosomal nonhomologous end-joinings, and nuclease attacks [19][20][21]. Telomeric G-quadruplexes were first reported as novel intramolecular structures containing guanine-guanine base-pairs in single-stranded telomeric sequences of several organisms [22], and as guaninetetrads between hairpin loops of the Tetrahymena telomeric DNA [23]. The importance of monovalent cations in the stabilization of G-quadruplex structures was revealed by Williamson, Cech in their monovalent cation-induced square-planar G-quartet model using the Oxytricha and Tetrahymena telomeric DNA [14]. Human telomeres consist of tandem repeats of the hexanucleotide d (TTAGGG) n 5-10 kb in length, which terminate in a singlestranded 3 0 -overhang of 35-600 bases [24]. Telomeres of cancer cells do not shorten upon replication, mainly due to the activation of a reverse transcriptase, telomerase, that extends the telomeric sequence at the chromosome ends [25]. Telomerase is activated in 80-85% of hu...

show abstract

Section: G-quadruplex-interactive Small Moleculesmentioning

confidence: 99%

G-Quadruplex DNA and RNA

Yang

2019

Methods in Molecular Biology

View full text Add to dashboard Cite

show abstract

“…Given that the overnight addition of anti-HT can unfold a large percentage of the G4 structures of HT23, but the overnight addition of anti-MYC can unfold a small percentage of the G4 structures of MYC22, we anticipate whether such difference in vitro is due to their G4 melting temperatures. We additionally studied three G4 structures, including GGGCGCGGGAGGAATTGGGCGGG (bcl2-M) originating from the middle four G-tracts of the P1 promoter in the bcl-2 gene [ 17 , 47 ], TAGGGAGGGTAGGGAGGGT (CMA) originating from the 5′-end of the c-MYC promoter NHE III 1 [ 48 , 49 ], and a mitochondrial sequence GGCGTAGGTTTGGTCTAGGG (mt9437) located at positions 7114–7133 in the reversed mtDNA of the NC_012920 reference sequence, upon the addition of their antisense sequences in 100 mM K + solution. The UV shadowing clearly showed the duplex formation of these pairs of G-rich/antisense sequences ( Figure S1A ).…”

Section: Discussionmentioning

confidence: 99%

Antisense Oligonucleotides Used to Identify Telomeric G-Quadruplexes in Metaphase Chromosomes and Fixed Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci

et al. 2020

View full text Add to dashboard Cite

Identification of the existence of G-quadruplex (G4) structure, from a specific G-rich sequence in cells, is critical to the studies of structural biology and drug development. Accumulating evidence supports the existence of G4 structure in vivo. Particularly, time-gated fluorescence lifetime imaging microscopy (FLIM) of a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), was used to quantitatively measure the number of G4 foci, not only in different cell lines, but also in tissue biopsy. Here, circular dichroism spectra and polyacrylamide gel electrophoresis assays show that the use of antisense oligonucleotides unfolds their G4 structures in different percentages. Using antisense oligonucleotides, quantitative measurement of the number of o-BMVC foci in time-gated FLIM images provides a method for identifying which G4 motifs form G4 structures in fixed cells. Here, the decrease of the o-BMVC foci number, upon the pretreatment of antisense sequences, (CCCTAA)3CCCTA, in fixed cells and at the end of metaphase chromosomes, allows us to identify the formation of telomeric G4 structures from TTAGGG repeats in fixed cells.

show abstract

“…Interaction with a G‐quadruplex from the promoter region of the c‐myc oncogene revealed that they interact at 1:2 binding stoichiometry. Calculations showed that binding occurs mainly through π‐π stacking between the polyaromatic core of the ligand and guanine residues of the outer G‐quartets …”

Section: Pyrido[234‐kl]acridinementioning

confidence: 99%

Pyridoacridines in the 21st Century

Joule

Álvarez

2019

Eur J Org Chem

View full text Add to dashboard Cite

This minireview summarizes the work developed during this century with compounds containing the pyridoacridine scaffold in its different isomeric forms. The isolation of natural products, syntheses, bioactivities, chelation capacity, and other properties of compounds containing this framework are discussed. For reasons of length, only compounds containing a maximum of seven condensed rings have been considered, with a few exceptions.

show abstract

NMR Structure of a Triangulenium‐Based Long‐Lived Fluorescence Probe Bound to a G‐Quadruplex

Cited by 60 publications

References 36 publications

G-Quadruplex DNA and RNA

G-Quadruplex DNA and RNA

Antisense Oligonucleotides Used to Identify Telomeric G-Quadruplexes in Metaphase Chromosomes and Fixed Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci

Pyridoacridines in the 21st Century

Contact Info

Product

Resources

About