Variability of the coat protein gene of Grapevine leafroll-associated virus 3 in Brazil

Abstract

Leafroll is an economically important disease affecting grapevines (Vitis spp.). Nine serologically distinct viruses, Grapevine leafroll-associated virus-1 through 9, are associated with this disease. The present study describes the coat protein gene sequence of four GLRaV-3 isolates occurring in the São Francisco River basin, Northeastern Brazil. The viral RNA was extracted from GLRaV-3 ELISA-positive plants and the complete coat protein gene was amplified by RT-PCR. Sequences were generated automatically and compared to the complete coat protein sequence from North American (NY1) and Chinese (Dawanhong Nº2 and SL10) GLRaV-3 isolates. The four studied isolates, named Pet-1 through 4, showed deduced amino acid identities of 98-100% (Pet-1 through 3) and 95% (Pet-4) with North American and Chinese isolates. A total of seventeen amino acid substitutions was detected among the four characterized isolates in comparison to the NY1, Dawanhong No.2 and SL10 sequences. The results indicated the existence of natural variation among GLRaV-3 isolates from grapevines, also demonstrating a lack of correlation between sequence data and geographic origin. This variability should be considered when selecting regions of the viral genome targeted for reliable and consistent virus molecular detection.Additional keywords: Closteroviridae, Ampelovirus, GLRaV-3. RESUMOVariabilidade do gene da proteína capsidial do Grapevine leafroll-associated virus 3 no Brasil O enrolamento da folha é uma doença economicamente importante que afeta videiras (Vitis spp.). Nove vírus sorologicamente distintos, Grapevine leafroll-associated virus-1 a -9, estão associados à doença. Este estudo descreve a seqüência do gene da proteína capsidial de quatro isolados do GLRaV-3 encontrados no Vale do Rio São Francisco, Nordeste do Brasil. O RNA viral foi extraído de plantas positivas em ELISA para o GLRaV-3 e o gene da proteína capsidial completo foi amplificado por RT-PCR. As seqüências foram geradas automaticamente e comparadas a seqüências completas do gene da proteína capsidial de isolados Norte-Americano (NY1) e Chineses (Dawanhong N°2 e SL10) de GLRaV-3. Os quatro isolados estudados, denominados Pet-1 a 4, exibiram identidades de aminoácidos deduzidos de 98-100% (Pet-1 a 3) e 95% (Pet-4) com os isolados Norte-Americano e Chineses. Um total de dezessete substituições de aminoácidos foi detectado entre os quatro isolados caracterizados em comparação com as seqüências do NY1, Dawanhong No.2 e SL10. Os resultados indicaram a existência de variação natural entre os isolados de GLRaV-3 de videiras, demonstrando também a falta de correlação entre dados de sequência e origem geográfica. Esta variabilidade deve ser considerada quando se selecionam regiões do genoma viral para uma detecção molecular confiável e consistente.Palavras-chave adicionais: Closteroviridae, Ampelovirus, GLRaV-3.

Incidência de vírus em videiras no Nordeste brasileiro e caracterização molecular parcial de isolados virais locais

“…A identidade de aad entre todos os isolados de GLRaV-3 analisados foi de 94,9% a 100% (Tabela 3). Variabilidade entre isolados de GLRaV-3 já havia sido verificada (FAJARDO et al, 2007), inclusive considerando alguns isolados provenientes do Nordeste brasileiro. Apesar das variações mais acentuadas terem sido verificadas nas sequências de nucleotídeos, as sequências de aminoácidos deduzidos das proteínas capsidiais tendem a apresentar menor variação entre os isolados de regiões geográficas distintas (Tabelas 1, 2 e 3).…”

Molecular characterization of GSyV-1 and GLRaV-3 and prevalence of grapevine viruses in a grape-growing area

“…Additionally, other three isolates of GSyV-1 collected in an experimental vineyard in Bento Gonçalves, southern Brazil (Latitude 29º10'17" S, Longitude 51º31'09" W and altitude 691 m), were characterized. The primer pairs used to amplify GSyV-1 by one-step RT-PCR were GVQCP-R (5'GCATTGCTGCGCATTGGAGG3'), GVQCP-F (5'TCCCAGCTTCAGGGTGAATT3') and GLRaV-3 were LR3-9445c (5'CTACTTCTTTTGCAATAGTT3') and LR3-8504v (5'ATGGCATTTGAACTGAAATT3') (Fajardo et al, 2007), complementary and viral sense, respectively. The RT-PCR in a single step was carried out using the One Step RT-PCR kit (Qiagen) and reactions were carried out according to the manufacturer with 4 μL of total RNA (ca.…”

Expression of Grapevine leafroll-associated virus 3 coat protein gene in Escherichia coli and production of polyclonal antibodies

“…The coat protein (CP) gene of GLRaV-3, isolate Pet-4, from grapevine cv. Petite Syrah collected in Petrolina, Pernambuco, Brazil, was amplified by RT-PCR with the oligonucleotides 8504 (5' ATGGCATTTGAACTGAAATT 3', viral sense) and 9445 (5' CTACTTCTTTTGCAATAGTT 3', complementary sense), ligated into the pGEM-T-Easy vector (Promega), cloned in E. coli DH5α and completely sequenced (GenBank access number A�753208) (Fajardo et al, 2007). One recombinant clone containing the CP gene of GLRaV-3 (GLRaV-3cp, 942 bp) was cultured for 8 h at 37 °C in LB medium with 100 µg/mL ampicilin (LB/ampicilin), and the plasmid DNA was purified using the Flexi Prep kit (Amersham Biosciences), according to the manufacturer's instructions.…”

“…The antibodies produced against the recombinant antigen GLRaV-3cp isolate Pet-4 were not tested against GLRaV-3 isolates Pet-1 to Pet-3, all collected in Northeastern Brazil, from which Pet-4 was shown to differ by only 11 amino acids (Fajardo et al, 2007). However, these antibodies were tested and recognized GLRaV-3 in other infected samples of different origins, such as distinct accessions of Cabernet Sauvignon (A 405nm = 1.02), Centennial (1.04), Chardonnay (1.07) and Clara (0.94) cultivars (healthy grapevine A 405nm = 0.26).…”