Urine sample used for congenital toxoplasmosis diagnosis by PCR

Fuentes, Isabel; Rodríguez, Martha Solangel; Domingo, C.; Castillo, Fernando del; Juncosa, T; Alvar, Jorge

doi:10.1128/jcm.34.10.2368-2371.1996

Cited by 70 publications

(24 citation statements)

References 27 publications

(29 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Toxoplasmosis is a serious endemic disease caused by an intracellular parasite called Toxoplasma gondii (T. gondii). According to the seroepidemiological studies, this parasite infects about 15-85% of the total population of the world [1][2][3]. The only known definitive hosts for T. gondii are members of family Felidae, including domestic and wild cats.…”

Section: Introductionmentioning

confidence: 99%

The global seroprevalence of anti-Toxoplasma gondii antibodies in women who had spontaneous abortion: A systematic review and meta-analysis

et al. 2020

View full text Add to dashboard Cite

Background Toxoplasma gondii (T. gondii) is an intracellular pathogen that can lead to abortion in pregnant women infected with this parasite. Therefore, the present study aimed to estimate the global seroprevalence of anti-T. gondii antibodies in women who had spontaneous abortion based on the results of published articles and evaluate the relationship between seroprevalence of anti-T. gondii antibodies and abortion via a systematical review and meta-analysis. Methods Different databases were searched in order to gain access to all studies on the seroprevalence of anti-T. gondii antibodies in women who had spontaneous abortion and association between seroprevalence of anti-T. gondii antibodies and abortion published up to April 25 th , 2019. Odds ratio (OR) and the pooled rate seroprevalence of T. gondii with a 95% confidence interval (CI) were calculated using the random effects model.

show abstract

Section: Introductionmentioning

confidence: 99%

The global seroprevalence of anti-Toxoplasma gondii antibodies in women who had spontaneous abortion: A systematic review and meta-analysis

et al. 2020

View full text Add to dashboard Cite

show abstract

“…Determination of intraocular production of antitoxoplasmic antibodies has been performed previously, but the results obtained had erratic values (2,21). PCR has mostly been used to detect T. gondii in different biological samples (4,9,12,14,19). Aqueous humor samples from patients with ocular toxoplasmosis have also been used with the PCR technique (1,2,10,18,21).…”

Section: Discussionmentioning

confidence: 99%

“…Detection of locally produced antibodies may be useful for immunocompetent patients but is probably not useful for immunocompromised patients. PCR detects the DNAs of microorganisms and is a rapid method which has been used to detect T. gondii DNA in different biological samples (4,9,12,14,19). Most of these samples can be obtained only by invasive procedures, and only blood can easily be obtained from the patients.…”

mentioning

confidence: 99%

Value of PCR for Detection of Toxoplasma gondii in Aqueous Humor and Blood Samples from Immunocompetent Patients with Ocular Toxoplasmosis

Bou¹,

Figueroa

Martí-Belda³

et al. 1999

J Clin Microbiol

View full text Add to dashboard Cite

Toxoplasma gondii infection is an important cause of chorioretinitis in the United States and Europe. Most cases ofToxoplasma chorioretinitis result from congenital infection. Patients are often asymptomatic during life, with a peak incidence of symptomatic illness in the second and third decades of life. Diagnosis is mainly supported by ophthalmological examination and a good response to installed therapy. However, establishment of a diagnosis by ophthalmological examination alone can be difficult in some cases. To determine the diagnostic value of PCR for the detection of T. gondii, 56 blood and 56 aqueous humor samples from 56 immunocompetent patients were examined. Fifteen patients with a diagnosis of ocular toxoplasmosis had increased serum anti-T. gondii immunoglobulin G levels but were negative for anti-T. gondii immunoglobulin M (group 1), and 41 patients were used as controls (group 2). Samples were taken before antiparasitic therapy was initiated, and only one blood sample and one aqueous humor sample were obtained for each patient. Single nested PCRs and Southern blot hybridization were performed with DNA extracted from these samples. The results obtained showed sensitivity and specificity values of 53.3 and 83%, respectively. Interestingly, among all patients with ocular toxoplasmosis, a positive PCR result with the aqueous humor sample was accompanied by a positive PCR result with the blood sample. This result suggests that ocular toxoplasmosis should not be considered a local event, as PCR testing of blood samples from patients with ocular toxoplasmosis yielded the same result as PCR testing of aqueous humor samples. PCR testing may be useful for discriminating between ocular toxoplasmosis and other ocular diseases, and also can avoid the problems associated with ocular puncture.

show abstract

“…The presence of T. gondii DNA in the samples was addressed by a Nested PCR in which the target was part of the sequence of the repetitive gene B1 [5], following the protocol previously published with some modifications [19]. T. gondii DNA amplification was carried out in a 25-µL reaction volume containing 80 ng of target DNA, 1.5 mM of MgCl2, 0.2 mM of dNTPs, 1 U/reaction of Taq polymerase, 1× buffer, 0.5 pmol/µL of primers, and Milli-Q Water qsp.…”

Section: Nested Pcr To Detect Toxoplasma Gondii Dnamentioning

confidence: 99%

“…PCR products were purified using PureLink® Quick Gel Extraction Kit 2 according to manufacturer's instructions, and sequence analysis was performed using primer Np7, 5'GGGTGAACCGAGGGAGTTG3', to identify the DNA sequence of N. caninum [3] and primer 5'TGCATAGGTTGCCAGTCACTG'3, which corresponds to the gene B1 nucleotides 853-831, to identify the DNA sequence of T. gondii [19]. Sequence analysis was performed using the Big Dye Terminator Kit (Applied Biosystems) according to manufacturer's instructions in an ABI DNA Model 3500 Series Genetic Analyzer (Applied Biosystems).…”

Section: Sequencing Analysismentioning

confidence: 99%

Detection of Neospora caninum and Toxoplasma gondii in Semen of Naturally Infected Rams

Koch

Dittrich

Weiss

et al. 2019

Acta Scientiae. Vet.

View full text Add to dashboard Cite

Background: Neospora caninum and Toxoplasma gondii are closely related cyst-forming apicomplexan parasites identified as important causes of reproductive failure in cattle. Moreover, abortion cases attributed to N. caninum and T. gondii infection have been occasionally reported in sheep. Due to the relatively scarce information on the molecular detection of N. caninum in the semen of naturally infected rams, this study aimed to detect parasitic DNA in fresh semen samples and in frozen extended semen straws from male sheep from artificial inseminations centers in Southern Brazil.Materials, Methods & Results: Semen samples of 38 rams from artificial insemination centers were evaluated. Eleven rams were naturally infected (seropositive for anti-N. caninum and/or anti-T. gondii IgG) and were selected for fresh semen collection. We tested all the samples for the closely related protozoan T. gondii to detect a possible cross-reaction and co-infection, due to the close similarity with N. caninum. The indirect fluorescent antibody test was used to detect IgG antibodies in the 11 serum samples from rams. Fresh semen samples were collected from 11 rams on days 1, 50, 55, and 58 using an artificial vagina and ewe in estrus. Other 27 rams had their frozen extended semen straws analyzed. A total of 20 fresh semen samples and 27 frozen extended semen straws samples were used to detect the presence of N. caninum and T. gondii DNA by polymerase chain reaction (PCR). Nc-5 and B1 genes were used as target regions to detect N. caninum and T. gondii DNA, respectively. The presence of N. caninum DNA was confirmed in the third collection of a fresh semen sample of one seropositive ram. T. gondii DNA was detected in a fresh semen sample of one seropositive ram. The DNA sequences of 186 bp from N. caninum (GenBank accession: MH806393) and 492 bp from T. gondii (GenBank accession: MH793503) were obtained by sequencing, and analysis revealed 99% and 100% identity, respectively, compared with other sequences deposited at GenBank. N. caninum and T. gondii DNAs were not detected in any of the 27 frozen extended semen straws used for artificial insemination.Discussion: This study demonstrated the presence of N. caninum and T. gondii DNA in fresh semen samples of naturally infected rams. The non-detection of N. caninum and T. gondii DNA in frozen semen samples of rams could be due to the dilution that was used to prepare the semen straws (GGL diluent and 5% glycerol), since fresh semen samples were not diluted prior to the test. Moreover, in our study, the volume of frozen semen samples (0.25 mL) used for PCR was lower than the volume of sediment obtained from fresh semen (0.5 mL), and the fresh semen centrifugation to obtain the sediment may have grouped the tachyzoites, increasing the sensitivity of the technique employed. No high IgG serological titers were detected in the rams at the time they were eliminating the parasite through fresh semen. The final titer of anti-N. caninum and anti-T. gondii IgGs in serum was 1:100, suggesting chronic infection. It is suggested that a new parasite elimination pathway is occurring among rams used for reproduction, due to the presence of N. caninum and T. gondii DNA in fresh semen samples from seropositive animals. Although the detection of genomic DNA of N. caninum and T. gondii in semen does not necessarily imply the presence of infectious stages of the parasites and does not determine their viability, these results demonstrate the need for further studies. Our study also indicates the need to reinforce preventive measures for sheep in artificial insemination centers until the risks are evaluated, by performing serological examinations with anti-N. caninum and anti-T. gondii antibodies, for instance, to select the rams that will be used for breeding.

show abstract

Urine sample used for congenital toxoplasmosis diagnosis by PCR

Cited by 70 publications

References 27 publications

The global seroprevalence of anti-Toxoplasma gondii antibodies in women who had spontaneous abortion: A systematic review and meta-analysis

The global seroprevalence of anti-Toxoplasma gondii antibodies in women who had spontaneous abortion: A systematic review and meta-analysis

Value of PCR for Detection of Toxoplasma gondii in Aqueous Humor and Blood Samples from Immunocompetent Patients with Ocular Toxoplasmosis

Detection of Neospora caninum and Toxoplasma gondii in Semen of Naturally Infected Rams

Contact Info

Product

Resources

About