Tyrosine kinases play a permissive role in glucose-induced insulin secretion from adult rat islets

Persaud, Shanta J.; Harris, Tracey E.; Burns, Christopher J.; Jones, Peter M.

doi:10.1677/jme.0.0220019

Cited by 57 publications

(45 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…As ISO, sobretudo a genisteína, aumentam a lipólise em adipóci-tos isolados de ratos, e diminuem a lipogênese no tecido adiposo branco de ratas OVX (48). A incubação de adipócitos de ratos com genisteína resultou inibição da conversão da glicose em lipídios na ausência ou na presença de insulina, com subseqüente redução da lipogê-nese (49,50). Outra ação da genisteína é a diminuição da expressão do RNA mensageiro da LPL no tecido adiposo, com conseqüente diminuição na deposição de gordura (44).…”

Section: Isofl Avonas E Adiposidadeunclassified

O tratamento com isoflavonas mimetiza a ação do estradiol no acúmulo de gordura em ratas ovariectomizadas

Torrezan

Gomes

Ferrarese

et al. 2008

Arq Bras Endocrinol Metab

View full text Add to dashboard Cite

RESUMOObjetivo: As isofl avonas (ISO) presentes na soja são consideradas fi toestrógenos. A administração de fi toestrógenos tem efeito benéfi co nos distúrbios da pós-menopausa que são caracterizados pela suspensão da função ovariana com declínio da secreção de estrogênio e conseqüentes desajustes histomorfológicos e metabóli-cos. O objetivo do presente estudo foi investigar o efeito da suplementação com ISO sobre a espessura do endométrio uterino, o acúmulo de gordura tecidual, o colesterol HDL e a glicose plasmática de ratas ovariectomizadas (OVX ABSTRACT Treatment with Isofl avones Replaces Estradiol Effect on the Tissue Fat Accumulation from Ovariectomized Rats.Objective: Isofl avones (ISO) present in soybean are named phytoestrogens because they show estrogen effect. The use of isofl avones has benefi cial effect in disturbance of post-menopause, which is characterized by ovarian function suppression. Decreasing of estrogen secretion and consequent morphologic and metabolic disarrangements are observed in female hormonal decline. The aim of present work was to investigate the effect of ISO on the fat accretion of uterin endometric tissue, and HDL and glucose blood concentration from ovariectomized rats (OVX). Methods: Female Wistar rats with 60 days-old were submitted a surgery to remove bilaterally the ovarium. After 8-day recovery period the animals were distributed into three groups: sham operate (GC); OVX ISO untreated (GI) and OVX supplemented with ISO (G II). Total uterus mass, uterus fat and retroperitoneal fat pad, were removed, washed and weighted. Samples of uterus were histological processed to measure endometrium thickness. Blood samples were also collected to analyze the concentration of HDL and glucose. The OVX caused endometric atrophy, decrease of uterus weight and HDL reduction. The treatment with ISO provoked decrease of uterin and retroperitoneal fat pad. HDL increase and glycemia reduction were also observed. However, there was no uterotrophic effect. Conclusions: ISO treatment causes decrease in tissue fat accretion from ovariectomized rats. (Arq Bras Endocrinol Metab 2008; 52/9:1489-1496)

show abstract

Section: Isofl Avonas E Adiposidadeunclassified

O tratamento com isoflavonas mimetiza a ação do estradiol no acúmulo de gordura em ratas ovariectomizadas

Torrezan

Gomes

Ferrarese

et al. 2008

Arq Bras Endocrinol Metab

View full text Add to dashboard Cite

show abstract

“…Moreover, signaling by receptor tyrosine kinases has been implicated as a regulatory mechanism in both β cell proliferation (12)(13)(14) and insulin release (9,(15)(16)(17)(18)(19). In particular, insulin/IGF signaling through insulin receptor substrate (IRS) and phosphoinositide 3-kinase (PI 3-kinase) appears to regulate several aspects of β cell function.…”

Section: Introductionmentioning

confidence: 99%

Defective insulin secretion in pancreatic β cells lacking type 1 IGF receptor

Xuan¹,

Kitamura²,

Nakae³

et al. 2002

J. Clin. Invest.

107

104

View full text Add to dashboard Cite

Defective insulin secretion is a feature of type 2 diabetes that results from inadequate compensatory increase of β cell mass and impaired glucose-dependent insulin release. β cell proliferation and secretion are thought to be regulated by signaling through receptor tyrosine kinases. In this regard, we sought to examine the potential proliferative and/or antiapoptotic role of IGFs in β cells by tissuespecific conditional mutagenesis ablating type 1 IGF receptor (IGF1R) signaling. Unexpectedly, lack of functional IGF1R did not affect β cell mass, but resulted in age-dependent impairment of glucose tolerance, associated with a decrease of glucose-and arginine-dependent insulin release. These observations reveal a requirement of IGF1R-mediated signaling for insulin secretion. February 2, 2002, and accepted Although the roles of IGFs in β cells have not been completely elucidated, these ligands and their cognate receptors are both expressed in this tissue (32)(33)(34)(35). Interestingly, the developmental wave of β cell apoptosis observed in neonatal rats (36) is associated with a decrease in IGF-2 expression (32, 37), leading to the suggestion that the IGFs have an antiapoptotic function in β cells. On the other hand, overexpression of IGF-2 in β cells (38), but not in liver (39,40), results in diabetes, presumably through increased insulin production with concomitant downregulation of insulin sensitivity. Received for publicationA potential role for IGF1R acting as a mediator of β cell proliferation through IRS-2 has been implied by observations indicating that the β cell failure observed in Irs2 -/-mice is exacerbated by Igf1r haploinsufficiency (13). However, generalized lack of IGF1R is lethal in the immediate postnatal period (41), thus precluding an extensive analysis of the role of IGF signaling in β cell physiology. To circumvent this limitation and analyze the role of IGF1R in β cells, we have used conditional mutagenesis with the cre/loxP site-specific recombination system to generate mice lacking IGF1R specifically in pancreatic β cells. Here we show that these mutant mice are glucose intolerant and exhibit an insulin secretion defect. MethodsMice. Animals carrying a floxed Igf1r allele (Igf1r lox ) (42) or a null Igf1r allele (Igf1r +/-) (41) and transgenic mice expressing the Cre recombinase under the transcriptional control of the rat insulin-2 promoter (InsPr-Cre) (43) have been described previously. A mating program with Igf1r +/-, Igf1r lox/+ , and InsPr-Cre mice was used to generate progeny of five genotypes: Igf1r +/-, Igf1r lox/+ , Igf1r lox/-, Igf1r ∆lox/-, and Igf1r ∆lox/+ (in which exon 3 sequences have been deleted as a result of Cre-mediated recombination). PCR analysis was used for genotyping. The wild-type, null, and Igf1r lox alleles were detected with primer 5′ CTTCCCAGCTTGCTACTCTAGG 3′ (P1, forward, located upstream of the second loxP site) and 5′ CAGGCTTGCAATGAGACATGGG 3′ (P2, reverse, located downstream of the same loxP site) (Figure 1). The Igf1r ∆lox allele was detected using a ...

show abstract

“…Several earlier studies demonstrated that genistein stimulates insulin secretion from a clonal pancreatic ␤-cell line (8) and cultured islets (9,10), whereas other studies have found an inhibitory effect on insulin secretion (11,12). These discrepant data may be the result of variations in the experimental conditions and model used.…”

mentioning

confidence: 98%

Genistein Acutely Stimulates Insulin Secretion in Pancreatic β-Cells Through a cAMP-Dependent Protein Kinase Pathway

et al. 2006

View full text Add to dashboard Cite

Although genistein, a soy isoflavone, has beneficial effects on various tissues, it is unclear whether it plays a role in physiological insulin secretion. Here, we present evidence that genistein increases rapid glucose-stimulated insulin secretion (GSIS) in both insulin-secreting cell lines (INS-1 and MIN6) and mouse pancreatic islets. Genistein elicited a significant effect at a concentration as low as 10 nmol/l with a maximal effect at 5 mol/l. The effect of genistein on GSIS was not dependent on estrogen receptor and also not related to an inhibition of protein tyrosine kinase (PTK). Consistent with its effect on GSIS, genistein increases intracellular cAMP and activates protein kinase A (PKA) in both cell lines and the islets by a mechanism that does not involve estrogen receptor or PTK. The induced cAMP by genistein, at physiological concentrations, may result primarily from enhanced adenylate cyclase activity. Pharmacological or molecular intervention of PKA activation indicated that the insulinotropic effect of genistein is primarily mediated through PKA. These findings demonstrated that genistein directly acts on pancreatic ␤-cells, leading to activation of the cAMP/PKA signaling cascade to exert an insulinotropic effect, thereby providing a novel role of soy isoflavones in the regulation of insulin secretion. Diabetes 55:1043-1050, 2006 S oy isoflavones have received widespread attention over the past few years because of their potential for preventing some highly prevalent chronic diseases. Genistein, the primary soy-derived isoflavone, has various biological actions, including a weak estrogenic effect by binding to estrogen receptors (1) and inhibiting protein tyrosine kinases (PTKs) (2). Studies on whether genistein has an effect on diabetes are very limited. Recent studies performed in animals and humans have shown that ingestion of soy protein associated with isoflavones moderates hyperglycemia (3,4), suggesting a beneficial role for soy in diabetes. However, it is not clear whether the beneficial effect of soy protein is due to genistein or other components. Data from recent animal studies suggest an antidiabetic effect of genistein presumably by a hypolipidemic effect (5). However, recent reports demonstrated that soy isoflavone administration lowered plasma glucose, whereas triglyceride levels were unaffected in obese and diabetic animals (6) and postmenopausal women (7). Therefore, although these data suggest that genistein may have a protective role in diabetes, the mechanism underlying these beneficial effects is still largely unknown.Few data exist on whether genistein has a direct effect on pancreatic ␤-cells. Several earlier studies demonstrated that genistein stimulates insulin secretion from a clonal pancreatic ␤-cell line (8) and cultured islets (9,10), whereas other studies have found an inhibitory effect on insulin secretion (11,12). These discrepant data may be the result of variations in the experimental conditions and model used. Nevertheless, the doses used in most of these studi...

show abstract

Tyrosine kinases play a permissive role in glucose-induced insulin secretion from adult rat islets

Cited by 57 publications

References 32 publications

O tratamento com isoflavonas mimetiza a ação do estradiol no acúmulo de gordura em ratas ovariectomizadas

O tratamento com isoflavonas mimetiza a ação do estradiol no acúmulo de gordura em ratas ovariectomizadas

Defective insulin secretion in pancreatic β cells lacking type 1 IGF receptor

Genistein Acutely Stimulates Insulin Secretion in Pancreatic β-Cells Through a cAMP-Dependent Protein Kinase Pathway

Contact Info

Product

Resources

About