Troglitazone suppresses transforming growth factor-β1-induced collagen type I expression in keloid fibroblasts

Gy, Zhang; Cg, Yi; X, Li; B, Ma; Zj, Li; Xl, Chen; Guo, Sz; Gao, Wenyuan

doi:10.1111/j.1365-2133.2008.08989.x

Cited by 36 publications

(36 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This nuclear receptor prevents fibrosis primarily by inhibiting TGF-␤-mediated signaling, and PPAR␥ ligands have been shown to inhibit TGF-␤-stimulated profibrotic differentiation of lung fibroblasts and reduce lung scarring in animal models of fibrosis (59). In addition, the PPAR␥ ligand troglitazone prevents TGF-␤-mediated collagen synthesis in keloid fibroblasts (76) and reduces renal interstitial fibrosis via inhibition of TGF-␤ signaling (33). Consistent with these data, fibroblasts lacking PPAR␥ show increased Smad signaling and consequent collagen expression (25).…”

Section: Discussionmentioning

confidence: 99%

Integrin α1β1 Regulates Epidermal Growth Factor Receptor Activation by Controlling Peroxisome Proliferator-Activated Receptor γ-Dependent Caveolin-1 Expression

Chen¹,

Whiting²,

Borza³

et al. 2010

Molecular and Cellular Biology

View full text Add to dashboard Cite

Integrin ␣1␤1 negatively regulates the generation of profibrotic reactive oxygen species (ROS) by inhibiting epidermal growth factor receptor (EGFR) activation; however, the mechanism by which it does this is unknown. In this study, we show that caveolin-1 (Cav-1), a scaffolding protein that binds integrins and controls growth factor receptor signaling, participates in integrin ␣1␤1-mediated EGFR activation. Integrin ␣1-null mesangial cells (MCs) have reduced Cav-1 levels, and reexpression of the integrin ␣1 subunit increases Cav-1 levels, decreases EGFR activation, and reduces ROS production. Downregulation of Cav-1 in wild-type MCs increases EGFR phosphorylation and ROS synthesis, while overexpression of Cav-1 in the integrin ␣1-null MCs decreases EGFR-mediated ROS production. We further show that integrin ␣1-null MCs have increased levels of activated extracellular signal-regulated kinase (ERK), which leads to reduced activation of peroxisome proliferator-activated receptor ␥ (PPAR␥), a transcription factor that positively regulates Cav-1 expression. Moreover, activation of PPAR␥ or inhibition of ERK increases Cav-1 levels in the integrin ␣1-null MCs. Finally, we show that glomeruli of integrin ␣1-null mice have reduced levels of Cav-1 and activated PPAR␥ but increased levels of phosphorylated EGFR both at baseline and following injury. Thus, integrin ␣1␤1 negatively regulates EGFR activation by positively controlling Cav-1 levels, and the ERK/PPAR␥ axis plays a key role in regulating integrin ␣1␤1-dependent Cav-1 expression and consequent EGFR-mediated ROS production.Integrins are transmembrane receptors for extracellular matrix components and are composed of noncovalently bound ␣ and ␤ subunits. In mammals, 1 of 18 ␣ subunits heterodimerizes with 1 of 8 ␤ subunits to form 24 distinct integrins, each with specific but overlapping functions (4, 29). Integrins regulate cellular processes such as cell adhesion, differentiation (2), cell cycle progression (26), reactive oxygen species (ROS) production (10, 72), and extracellular matrix synthesis and remodeling (23). In addition, integrins interact with and regulate the activity of different growth factor receptors (3), and this cross talk coordinates biological processes by regulating downstream signaling pathways (8,55,58,61). Integrin occupancy causes growth factor receptor autophosphorylation (44), and growth factor receptors and integrins associate following growth factor stimulation or integrin activation (5, 61, 73).Caveolin-1 (Cav-1) is one of the three members of the caveolin family and is a structural protein involved in the formation of caveola-rich membrane domains (64). Caveolae are clearly defined, small, flask-shaped invaginations of the plasma membrane enriched in sphingolipids and cholesterol and are implicated in transcytosis, lipid metabolism, and receptor trafficking (35). Changes in plasma membrane localization and/or expression of Cav-1 can profoundly affect Cav-1-mediated functions. Different factors can regulate Cav-1 expression at both tr...

show abstract

Section: Discussionmentioning

confidence: 99%

Integrin α1β1 Regulates Epidermal Growth Factor Receptor Activation by Controlling Peroxisome Proliferator-Activated Receptor γ-Dependent Caveolin-1 Expression

Chen¹,

Whiting²,

Borza³

et al. 2010

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…2A-C). As the translocation of Smads is a key step in TGF-b1 signaling [1,9,10], we next examined the effects of cav-1p on the nuclear translocation of these Smad proteins. Smad2 and Smad3 were predominantly localized in the cytosolic fraction of untreated HSFs; after incubation with TGF-b1, they were translocated to the nuclear fraction.…”

mentioning

confidence: 99%

“…Post transfection, according to our previously published methods [1,9], quantitative real-time reverse transcriptase-polymerase chain reaction, western blotting and cell viability assay were performed. The primers for PCR were used as follows: cav-1 (forward primer, CGACCCTAAACACCTCAACGA; reverse primer, TCCCTTCTGGTTCTGTCA), plasminogen activator inhibitor 1 (PAI-1, forward primer, TTTCAGAGGTGGAGAGAG; reverse primer, CAG-GATGTCGTAGT AATGG), a-SMA (forward primer, TTGAGAAGAGT-TACGAGTTG; reverse primer, GGACATTGTTAGCATAGAGG), and bactin (forward primer, AGCCATGTACGTAGCCATCC; reverse primer, CTCTCAGCTGTGGTGGTGAA).…”

mentioning

confidence: 99%

Caveolin 1 inhibits transforming growth factor-β1 activity via inhibition of Smad signaling by hypertrophic scar derived fibroblasts in vitro

Zhang

He²,

Liao³

et al. 2011

Journal of Dermatological Science

View full text Add to dashboard Cite

“…Collagen synthesis was evaluated by measuring 3 H-proline incorporation with some modifications [24]. In brief, TGF-b1-induced KFs were incubated with 1 lCi mL À1 3 H-proline (Atom-Hitech, China), aspidin PB.…”

Section: Collagen Synthesis Assaymentioning

confidence: 99%

Aspidin PB, a novel natural anti-fibrotic compound, inhibited fibrogenesis in TGF-β1-stimulated keloid fibroblasts via PI-3K/Akt and Smad signaling pathways

Ren-gang

Liu

2015

Chemico-Biological Interactions

View full text Add to dashboard Cite

Troglitazone suppresses transforming growth factor-β1-induced collagen type I expression in keloid fibroblasts

Abstract: Our data suggest that PPAR-gamma is present in keloid fibroblasts and PPAR-gamma activation inhibits TGF-beta1-induced collagen type I expression at least in part by decreasing collagen synthesis. PPAR-gamma may be a promising therapeutic target for keloids.

Cited by 36 publications

References 53 publications

Integrin α1β1 Regulates Epidermal Growth Factor Receptor Activation by Controlling Peroxisome Proliferator-Activated Receptor γ-Dependent Caveolin-1 Expression

Integrin α1β1 Regulates Epidermal Growth Factor Receptor Activation by Controlling Peroxisome Proliferator-Activated Receptor γ-Dependent Caveolin-1 Expression

Caveolin 1 inhibits transforming growth factor-β1 activity via inhibition of Smad signaling by hypertrophic scar derived fibroblasts in vitro

Aspidin PB, a novel natural anti-fibrotic compound, inhibited fibrogenesis in TGF-β1-stimulated keloid fibroblasts via PI-3K/Akt and Smad signaling pathways

Contact Info

Product

Resources

About