Transcriptomic analysis of human brain microvascular endothelial cells exposed to laminin binding protein (adhesion lipoprotein) and Streptococcus pneumoniae

Abstract

Streptococcus pneumoniae invades the CNS and triggers a strong cellular response. To date, signaling events that occur in the human brain microvascular endothelial cells (hBMECs), in response to pneumococci or its surface adhesins are not mapped comprehensively. We evaluated the response of hBMECs to the adhesion lipoprotein (a laminin binding protein—Lbp) or live pneumococci. Lbp is a surface adhesin recently identified as a potential ligand, which binds to the hBMECs. Transcriptomic analysis was performed by RNA-seq of three independent biological replicates and validated with qRT-PCR using 11 genes. In total 350 differentially expressed genes (DEGs) were identified after infection with S. pneumoniae, whereas 443 DEGs when challenged with Lbp. Total 231 DEGs were common in both treatments. Integrative functional analysis revealed participation of DEGs in cytokine, chemokine, TNF signaling pathways and phagosome formation. Moreover, Lbp induced cell senescence and breakdown, and remodeling of ECM. This is the first report which maps complete picture of cell signaling events in the hBMECs triggered against S. pneumoniae and Lbp. The data obtained here could contribute in a better understanding of the invasion of pneumococci across BBB and underscores role of Lbp adhesin in evoking the gene expression in neurovascular unit.

Plasmodium falciparum and TNF-α Differentially Regulate Inflammatory and Barrier Integrity Pathways in Human Brain Endothelial Cells

“…Quantitative real-time PCR was performed on the QuantStudio 7 Flex system (Applied Biosystems) using Power SYBR green (Applied Biosystems). Previously published primer sequences for the CCL2 , CXCL8 ( 76 ), IL6 , and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) ( 77 ) genes were used. Each sample was normalized to GAPDH threshold cycle values ( C T ), and expression was calculated by the ΔΔ C T method.…”

Signaling events evoked by domain III of envelop glycoprotein of tick-borne encephalitis virus and West Nile virus in human brain microvascular endothelial cells

“…An initial signaling is mounted immediately after binding of viral ligand to receptor by setting off an innate immune response to protect the cell. Although the HBMECs are not primary immune cells, several signaling events related to the innate immune response are evoked in response to the attachment of pathogen or its ligands on cell surface 78 – 80 . In the present study we found deregulation of several genes involved in immediate cell response mediated through pattern recognition receptors (PRRs) and downstream interferon signaling (Fig.…”

“…Libraries for RNA sequencing were prepared exactly as described in our previous publication 80 using QuantSeq 3′ mRNA-Seq Library Prep Kit (Lexogen, Austria). Details of library synthesis are presented in Supplementary Information Method S5 .…”

“…Amplification cycle was as follows: 95 °C—10 min, 40 × 95 °C—15 s, 50–60 °C—30 s (annealing temperature varied according to the primers used), 72 °C for 30 s (signal capture), melting curve 60–95 °C—0.3% temperature increment/s (StepOnePlus, Thermo Fisher Scientific, USA). The gene expression (ΔΔCt) was normalized to β-2-microglobulin (house-keeping gene) as described before 80 . ΔΔCt values were converted to logFC ( http://www.endmemo.com/algebra/log2.php ).…”

Frataxin-deficient human brain microvascular endothelial cells lose polymerized actin and are paracellularly permeable –implications for blood-brain barrier integrity in Friedreich’s Ataxia

“…FXN-F (TGGAATGTCAAAAAGCAGAGTG), FXN-R (CCACTCCCAAAGGAGACATC), β-2-Microglobulin-F (GCTCGCGCTACTCTCTCTTT), β-2-Microglobulin-R (CGGATGGATGAAACCCAGACA) 25 , and β-actin-F (GGGTCAGAAGGATTCCTATG), β-actin-R (GGTCTCAAACATGATCTGGG).…”