The development of decision limits for the implementation of the GH-2000 detection methodology using current commercial insulin-like growth factor-I and amino-terminal pro-peptide of type III collagen assays

Erotokritou‐Mulligan, Ioulietta; Guha, Nishan; Stow, Michael; Bassett, E. Eryl; Bartlett, Christiaan; Cowan, David; Sönksen, Peter H.; Holt, Richard

doi:10.1016/j.ghir.2011.12.005

Cited by 32 publications

(50 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Because each immunoassay platform has different reference ranges for IGF-1, it is difficult to provide specific guidelines for GH disease management. For antidoping applications, serum concentrations of IGF-1 and the N-terminal propeptide of type III procollagen are used in combination to detect GH abuse (5)(6)(7)(8)(9). This use of these 2 biomarkers was recently implemented in the 2012 Olympic Games in London and will soon be adopted in all 33 World Anti-Doping Agency (WADA)-accredited laboratories worldwide.…”

confidence: 99%

Interlaboratory Agreement of Insulin-like Growth Factor 1 Concentrations Measured by Mass Spectrometry

Cox¹,

Lopes

Woldemariam

et al. 2014

Clinical Chemistry

View full text Add to dashboard Cite

BACKGROUND:Insulin-like growth factor 1 (IGF-1) 7 is a key mediator of growth hormone (GH) action and a well-characterized biomarker of GH abuse. Current immunoassays for IGF-1 suffer from poor concordance between platforms, which makes comparison of results between laboratories difficult. Although previous work has demonstrated good interlaboratory imprecision of LC-MS/MS methods when plasma is supplemented with purified proteins, the interlaboratory imprecision of an endogenous protein in the nanogram-per-milliliter concentration range has not been reported.

show abstract

confidence: 99%

Interlaboratory Agreement of Insulin-like Growth Factor 1 Concentrations Measured by Mass Spectrometry

Cox¹,

Lopes

Woldemariam

et al. 2014

Clinical Chemistry

View full text Add to dashboard Cite

show abstract

“…The GH-2000 score was initially developed using immunoassays that are no longer available [4, 5]. Although the original discriminant function has remained unchanged, the decision limits have been updated as further experience has been accumulated and new assays have become available [6].…”

Section: Introductionmentioning

confidence: 99%

A correction to the age-adjustment of the GH-2000 score used in the detection of growth hormone misuse

Böhning

Guha

et al. 2018

BMC Res Notes

Self Cite

View full text Add to dashboard Cite

ObjectiveThe GH-2000 biomarker test has been introduced by the World Anti-Doping Agency as a method of detecting growth hormone misuse in professional sport. The test involves the measurement insulin-like growth factor-I and the amino-terminal pro-peptide of type III collagen (P-III-NP) which increase in a dose-dependent manner in response to GH. These measurements are combined in sex specific formulae that include an age adjustment. The original age adjustment overcorrects the effect of age in male athletes and could potentially place older men at a disadvantage. The purpose of this note is to investigate the performance of a previously suggested correction term in two new and larger data sets.ResultsThe GH-2000 score was calculated for 7307 samples obtained from 15 accredited WADA laboratories in 2017 and 3916 samples measured at Drug Control Centre, King’s College London, UK between 2013 and 2017. The GH-2000 scores were investigated for positive age effects using standard regression modelling. As previously, all analyses confirmed a positive age effect. Applying the earlier suggested correction term of 0.032 × age showed a significant over-correction leading to a negative association of the GH-2000 score with age. We now suggest a smaller age correction of 0.020 × age, which corresponds to the smallest effect found in the earlier studies.Electronic supplementary materialThe online version of this article (10.1186/s13104-018-3741-7) contains supplementary material, which is available to authorized users.

show abstract

“…The primers and PCR cycling conditions for GH and rtTA are described above. Genomic DNA (40 μg) from F0 pigs was digested overnight with E co RI (MBI Fermentas), separated through a 1% agarose gel and alkali-transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia Biotech, Buckinghamshire, UK), as described previously61. Probes were PCR-amplified from pTTGH DNA fragments using validated GH and rtTA primers, pGH-SL (5′ - CACCAACCTTGGGCTTTGGG - 3′ , forward) and pGH-SR (5′ - CACGGCGTTGGCAAATAGGC - 3′ , reverse), rtTA-L (5′ - CTGTGCTCTCCTCTCACATC- 3′ , forward) and rtTA-R (5′ - GAATCGGTGGTAGGT GTCTC - 3′ , reverse), which were digoxigenin (Dig)-labeled using a nick translation system (Innogent-cn, Shenzhen, China), according to the manufacturer’s instructions.…”

Section: Methodsmentioning

confidence: 99%

“…Blood samples (3 to 4 ml each) were collected from each pig 3 times per day, before feeding (at 6:00, 12:00 and 18:00), on 3 separate days before and after DOX injection. Separate serum samples were used to measure IGF-1 levels (HY-082, Sino-UK institute of Biological Technology Beijing, China) and GH levels (HY-037, Sino-UK institute of Biological Technology, Beijing, China) via the radioimmunoassay (RIA) method, according to the manufacturer’s protocol61.…”

Section: Methodsmentioning

confidence: 99%

The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production

Ju¹,

Zhang²,

Bai³

et al. 2015

Sci Rep

View full text Add to dashboard Cite

Sustained expression of the GH gene has been shown to have detrimental effects on the health of animals. In the current study, transgenic founder pigs, with controllable pig growth hormone (pGH) expression, were cloned via the handmade cloning method (HMC), and pGH expression levels were examined at the cellular and organismal levels. The serum pGH levels in 3 founder male pigs were found to be significantly higher after induction with intramuscular injection of doxycycline (DOX) compared to baseline. A daily dose of DOX was administered via feed to these animals for a period of 65 to 155 days. The growth rate, feed efficiency and pGH serum concentration increased in the DOX-induced transgenic group compared with the other groups. 8 numbers of animals were euthanized and the dressing percentage, loin muscle and lean meat percentage were significantly higher in the DOX-induced F1 transgenic group compared with the other groups. In this study a large population of transgenic pigs, with integrated controllable expression of a transgene, was obtained. The transgenic pigs were healthy and normal in terms of reproductive capability. At the same time, feed efficiency was improved, production processes were accelerated and meat yield was increased.

show abstract

The development of decision limits for the implementation of the GH-2000 detection methodology using current commercial insulin-like growth factor-I and amino-terminal pro-peptide of type III collagen assays

Cited by 32 publications

References 9 publications

Interlaboratory Agreement of Insulin-like Growth Factor 1 Concentrations Measured by Mass Spectrometry

Interlaboratory Agreement of Insulin-like Growth Factor 1 Concentrations Measured by Mass Spectrometry

A correction to the age-adjustment of the GH-2000 score used in the detection of growth hormone misuse

The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production

Contact Info

Product

Resources

About