The complete mitochondrial genome of the cryptic “lineage A” big-fin reef squid,
 Sepioteuthis lessoniana
 (Cephalopoda: Loliginidae) in Indo-West Pacific

Hsiao, Chung-Der; Shen, Kang‐Ning; Ching, Tzu-Yun; Wang, Ya-Hsien; Ye, Jeng-Jia; Tsai, Shiou-Yi; Wu, Shan-Chun; Chen, Ching-Hung; Wang, Chia-Hui

doi:10.3109/19401736.2015.1030630

Cited by 4 publications

(2 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Multiplex cytochrome oxidase c subunit I (COI) haplotype-specific PCR (MHS-PCR) was performed to identify the potential lineages of squids using the following primers: AF-5′-TCTCATGCTGGACCTTCAGTA-3′; AR-5′- TGCTCCTGCTAAAACAGGAAG -3′; BF-5′- ATTGGGGGTTTTGGTAACTGG -3′; BR-5′- GATGCTAAAAGGAGTGTGAGG -3′; C1F-5′- TTAGTTGGTACCTCACTAAGG -3′; C1R-5′- CTCTTTCAACTGCTGAGGAC -3′; C2F-5′- TTAGTTGGTACCTCACTAAGG -3′; C2R-5′- GTTGATATAGAATAGGGTCTCCC -3′. These haplotype-specific primers were designed based on bigfin reef squid samples collected around Taiwan ( Hsiao et al , 2016 ; Shen et al , 2016 ). PCR was performed using a PCR Thermal Cycler (Gene Atlas), each with 9.8‍ ‍μL of reaction solution containing 0.2‍ ‍ng template DNA, 0.3‍ ‍μM of each primer, 0.2‍ ‍mM dNTP mixture, 10× PCR buffer (20‍ ‍mM Tris–HCl pH 8.0, 15‍ ‍mM KCl, and 15‍ ‍mM MgCl 2 ), and 5‍ ‍U μL –1 DNA polymerase (Thermo Scientific).…”

Section: Methodsmentioning

confidence: 99%

Bacterial Dynamics in the Accessory Nidamental Gland of Sepioteuthis lessoniana throughout Maturation

et al. 2021

Self Cite

View full text Add to dashboard Cite

The accessory nidamental gland (ANG) is part of the reproduction organ in the majority of female cephalopods, including the bigfin reef squid Sepioteuthis lessoniana, an economically important fishery product. Microbes in Alphaproteobacteria, Gammaproteobacteria, and Verrucomicrobia have been suggested to play a role in the maturation of the S. lessoniana ANG and are responsible for its color. However, the bacterial composition and dynamics of the different maturation stages of the ANG remain unclear. In the present study, we surveyed ANG-associated bacterial dynamics in wild-caught S. lessoniana at various developmental stages in different populations over 3 years. The results obtained showed that the ANG bacterial community shifted gradually and decreased in diversity throughout maturation. Verrucomicrobia occupied the ANG during the early stages in large numbers, and was replaced by Bacteroidia, Alphaproteobacteria, and Gammaproteobacteria in the later stages. Flavobacteriales and Alphaproteobacteria both appeared to contribute to pigmentation, while Bacteroidia, Alphaproteobacteria, and Gammaproteobacteria may be involved in enriching the heme biosynthesis pathway in the ANG with the maturation of S. lessoniana. The present results provide an open question of whether S. lessoniana actively selects the bacterial community in the ANG to adjust to its surrounding environment.

show abstract

Section: Methodsmentioning

confidence: 99%

Bacterial Dynamics in the Accessory Nidamental Gland of Sepioteuthis lessoniana throughout Maturation

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…In recent years, the coexistence of three cryptic lineages of S. lessoniana has been reported in the Indo-Pacific Ocean (Cheng et al, 2014;Tomano et al, 2016). These cryptic lineages of S. lessoniana exhibit similar morphology but are genetically distinct (Akasaki et al, 2006;Hsiao et al, 2016;Shen et al, 2016). Although the extent of cryptic diversity within the S. lessoniana species complex in Taiwan remains unclear, a single cryptic lineage may be predominant in northern Taiwan and the Penghu Islands, based on the migration pattern prediction.…”

Section: Prediction Of Ontogenetic Movement and Geographical Distribumentioning

confidence: 99%

Seasonal Movement Patterns of the Bigfin Reef Squid Sepioteuthis lessoniana Predicted Using Statolith δ18O Values

et al. 2020

Self Cite

View full text Add to dashboard Cite

Sepioteuthis lessoniana is a widely distributed neritic squid in the Indo-Pacific Ocean. It is an important species in fisheries, but species management is difficult because of inadequate information regarding its life history. The daily growth and δ 18 O values from the core to the edge of statoliths of S. lessoniana collected in northern Taiwan were analyzed to predict the experienced temperature history along with ontogenetic stages. The probability of occurrence in a given area at each life stage in three seasonal groups was determined using salinity values, deduced and measured temperatures, and the known ecology of S. lessoniana. The results showed that ontogenetic variation in the statolith δ 18 O values in S. lessoniana reflected the seasonal temperature fluctuation observed in Taiwanese waters, which indicated the reliability of the prediction method. Complex and diverse distribution and movement patterns were observed in the three seasonal groups. The results also indicated the importance of the waters near the coast of northeastern Taiwan as a spawning ground. Based on a model prediction, the distribution of S. lessoniana is likely associated with water temperature and current. A potential migration route from the Penghu Islands to northeastern Taiwan suggests a high level of population connectivity in S. lessoniana in Taiwan. This study provides information on the spatial and vertical distribution of S. lessoniana at various ontogenetic stages, which is essential for resource management and conservation of this commercial species.

show abstract

Variations in life-history traits and statolith shape for Sepioteuthis spp. in the waters off southwestern Japan

et al. 2021

View full text Add to dashboard Cite

The complete mitochondrial genome of the cryptic “lineage A” big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) in Indo-West Pacific

Cited by 4 publications

References 4 publications

Bacterial Dynamics in the Accessory Nidamental Gland of <i>Sepioteuthis lessoniana</i> throughout Maturation

Bacterial Dynamics in the Accessory Nidamental Gland of <i>Sepioteuthis lessoniana</i> throughout Maturation

Seasonal Movement Patterns of the Bigfin Reef Squid Sepioteuthis lessoniana Predicted Using Statolith δ18O Values

Variations in life-history traits and statolith shape for Sepioteuthis spp. in the waters off southwestern Japan

Contact Info

Product

Resources

About