Synthetic biology approaches in regulation of targeted gene expression

Huang, Decai; Kosentka, Pawel Z; Liu, Wusheng

doi:10.1016/j.pbi.2021.102036

Cited by 21 publications

(8 citation statements)

References 82 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These genes should be the targets for genetic engineering, gene editing, and marker-assisted breeding to improve fruit lycopene content in tomato. Their promoters could also be engineered using gene editing [ 68 , 69 ] or synthetic biology [ 70 , 71 ] to fine-tune expression of these genes.…”

Section: Discussionmentioning

confidence: 99%

Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes

Duduit

Kosentka

Miller

et al. 2022

Horticulture Research

Self Cite

View full text Add to dashboard Cite

Lycopene content in tomato fruit is largely under genetic control and varies greatly among genotypes. Continued improvement of lycopene content in elite varieties with conventional breeding has become challenging, in part because little is known about the underlying molecular mechanisms in high-lycopene tomatoes (HLYs). We collected 42 HLYs with different genetic backgrounds worldwide. High-performance liquid chromatography (HPLC) analysis revealed lycopene contents differed among the positive control wild tomato Solanum pimpinellifolium, HLYs, the normal lycopene cultivar “Moneymaker”, and the non-lycopene cultivar NC 1Y at the pink and red ripe stages. Real-time RT-PCR analysis of expression of the 25 carotenoid biosynthesis pathway genes of each genotype showed a significantly higher expression in nine upstream genes (GGPPS1, GGPPS2, GGPPS3, TPT1, SSU II, PSY2, ZDS, CrtISO and CrtISO-L1 but not the well-studied PSY1, PDS and Z-ISO) at the breaker and/or red ripe stages in HLYs compared to Moneymaker, indicating a higher metabolic flux flow into carotenoid biosynthesis pathway in HLYs. Further conversion of lycopene to carotenes may be prevented via the two downstream genes (β-LCY2 and ε-LCY), which had low-abundance transcripts at either or both stages. Additionally, the significantly higher expression of four downstream genes (BCH1, ZEP, VDE, and CYP97C11) at either or both ripeness stages leads to significantly lower fruit lycopene content in HLYs than in the wild tomato. This is the first systematic investigation of the role of the complete pathway genes in regulating fruit lycopene biosynthesis across many HLYs, and enables tomato breeding and gene editing for increased fruit lycopene content.

show abstract

Section: Discussionmentioning

confidence: 99%

Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes

Duduit

Kosentka

Miller

et al. 2022

Horticulture Research

Self Cite

View full text Add to dashboard Cite

show abstract

“…One of the challenges in engineering genes in plants is controlling the spatiotemporal transgene expression (Venter, 2007;Liu et al, 2013;Huang et al, 2021). The expression of transgene is largely dependent on the selection of precise promoter.…”

Section: Discussionmentioning

confidence: 99%

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max)

et al. 2022

Self Cite

View full text Add to dashboard Cite

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

show abstract

“…In recent years, many results have been achieved in the research on artificial promoters [ 33 , 34 ]. However, it is less well understood how the basal levels and inducible activities of artificial promoters are affected by new elements [ 35 ]…”

Section: Discussionmentioning

confidence: 99%

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

Huang

Fang

et al. 2022

Genes

View full text Add to dashboard Cite

The transcriptional properties of artificial promoters are closely related to the type and arrangement position of cis-elements. GWSF (374-bp) was an effective SPIP with four cis-element dimers. There were four pathogen-inducible cis-elements in the GWSF promoter (GST1-boxes, W-boxes, S-boxes, and F-boxes) and a minimal cauliflower mosaic virus 35S promoter. V-element dimers were inserted into the upstream (VGWSF), midstream (GWVSF), and downstream (GWSFV) regions of the original GWSF promoter sequence to examine their affect on the position. The expression activity of promoters was analyzed and estimated using the histochemical staining of leaf discs of eucalyptus with transient expression, an image digitization method to extract the color features, and the induction treatment by a plant pathogenic microorganism/inducer and qPCR assays. The histochemical staining results of the adventitious buds indicated that the promoters had been successfully integrated into the E.urophylla genome and that they drove the expression of the gus gene. There was a noticeable difference in the intensity of color between the adventitious buds on the same callus block, as well as the intensity of color within the same adventitious bud. According to the established two-factor model of blue value, there was a greater difference between the levels of the genotype factor than the promoter factor in eucalyptus leaf discs. Further, the basal and inducible transcriptional levels of the three improved promoters were investigated by qPCR. With the basal transcriptional level of the GWSF promoter normalized to one, the relative basal levels of VGWSF, GWVSF, and GWSFV were 1.40, 1.45, and 4.15, respectively. The qPCR results were consistent with the staining results of GUS histochemical staining. The three improved promoters all had the properties of being induced by salicylic acid, Ralstonia solanacearum, and Phytophthora capsici. The three improved promoters demonstrated a significantly higher TMV induction activity: their induction activity from high to low was GWSFV > GWVSF > VGWSF. The findings will be beneficial to the construction and optimization of artificial promoters for transgenic plants.

show abstract

Synthetic biology approaches in regulation of targeted gene expression

Cited by 21 publications

References 82 publications

Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes

Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max)

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

Contact Info

Product

Resources

About