Survivorship of wild caught Mepraia spinolai nymphs: The effect of seasonality and Trypanosoma cruzi infection after feeding and fasting in the laboratory

Cabe, A. Mc; Yáñez, Francisco; Pinto, Raquel; López, A.I. López; Ortíz, Sylvia; Martín, Catalina Muñoz-San; Botto‐Mahan, Carezza; Solari, Aldo

doi:10.1016/j.meegid.2019.04.002

Cited by 13 publications

(9 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The protocol was carried out according to the manufacturer's instructions; the DNA was eluted twice with 100 µL of elution buffer. All samples were co-extracted with 100 pg of a sequence of Arabidopsis thaliana used as a heterologous internal amplification control (IAC) as previously described in Mc Cabe et al (2019) to discount loss of DNA or carryover of polymerase chain reaction (PCR) inhibitors.…”

Section: Dna Extraction From Triatomines and Blood Of Small Mammalsmentioning

confidence: 99%

“…Assays were performed in blood samples using primers IAC Fw (5 ACCGTCATGGAACAG CACGTA 3 ) and IAC Rv (5 CTCCCGCAACAAACCCTATAAAT 3 ) Duffy et al, 2013 at a final concentration of 0.2 µM and at a melting temperature of 58 • C as previously described in (Mc Cabe et al, 2019). Quantification of the parasite equivalents from DNA samples was calculated considering the amplification curve of standard T. cruzi DNA and the results were normalized according to the heterologous IAC results.…”

Section: Heterologous Internal Amplification Control Qpcr Assaysmentioning

confidence: 99%

See 1 more Smart Citation

Trypanosoma cruzi-infected triatomines and rodents co-occur in a coastal island of northern Chile

Campos‐Soto

Díaz-Campusano

Quiroga

et al. 2020

PeerJ

View full text Add to dashboard Cite

Trypanosoma cruzi, the cause agent of Chagas disease, is transmitted mainly by blood-feeding insects of the subfamily Triatominae. The T. cruzi life cycle alternates between triatomines and mammalian hosts, excluding birds and reptiles. Triatomines of Mepraia genus are wild vectors of T. cruzi in Chile. Mepraia specimens infected with T. cruzi have been detected in Pan de Azúcar and Santa María islands. The most common vertebrates that inhabit these islands are birds and reptiles, and it is unknown whether small mammals are present. Consequently, it is relevant to know whether there are any T. cruzi-infected small mammals on those islands to elucidate the T. cruzi cycle. To clarify this crossroads, islands of northern Chile were explored to determine if T. cruzi-infected triatomines and rodents co-occur in islands of northern Chile. T. cruzi DNA was detected by conventional and real-time PCR in three islands: on Santa María and Pan de Azúcar islands T. cruzi was detected in Mepraia sp samples, while on Pan de Azúcar (6.1%) and Damas islands (15%) was detected in the rodent Abrothrix olivacea. We show for the first time in Chile the occurrence of insular rodents infected with T. cruzi, and a complete T. cruzi life cycle in a coastal island. Our results provide new insights to understand the T. cruzi infection in the wild cycle.

show abstract

Section: Dna Extraction From Triatomines and Blood Of Small Mammalsmentioning

confidence: 99%

Section: Heterologous Internal Amplification Control Qpcr Assaysmentioning

confidence: 99%

Trypanosoma cruzi-infected triatomines and rodents co-occur in a coastal island of northern Chile

Campos‐Soto

Díaz-Campusano

Quiroga

et al. 2020

PeerJ

View full text Add to dashboard Cite

show abstract

“…Bugs arrived at the laboratory 1–2 days after collection, where they were classified by development stage and individually housed in a plastic box with several small-size compartments (3.2 × 3.6 × 1.5 cm) with an identification tag. All bugs were maintained in a growth chamber under optimal conditions at 26 °C, 75% relative humidity and 14:10 (L:D) h cycle [ 41 ]. Over a one week period after arrival, bugs were individually fed on uninfected mice ( Mus musculus ) anesthetized with 2% sodium thiopental.…”

Section: Methodsmentioning

confidence: 99%

“…cruzi infection in M . spinolai is higher in spring and summer compared to fall, and survivorship of the second stage nymphs is lower in spring than in the other seasons [ 41 ].…”

Section: Introductionmentioning

confidence: 99%

Trypanosoma cruzi infection follow-up in a sylvatic vector of Chagas disease: Comparing early and late stage nymphs

et al. 2021

View full text Add to dashboard Cite

Chagas disease is caused by Trypanosoma cruzi and transmitted by the triatomine Mepraia spinolai in the southwest of South America. Here, we examined the T. cruzi-infection dynamics of field-caught M. spinolai after laboratory feeding, with a follow-up procedure on bug populations collected in winter and spring of 2017 and 2018. Bugs were analyzed twice to evaluate T. cruzi-infection by PCR assays of urine/fecal samples, the first evaluation right after collection and the second 40 days after the first feeding. We detected bugs with: the first sample positive and second negative (+/-), the first sample negative and second positive (-/+), and with both samples positive or negative (+/+; -/-). Bugs that resulted positive on both occasions were the most frequent, with the exception of those collected in winter 2018. Infection rate in spring was higher than winter only in 2018. Early and late stage nymphs presented similar T. cruzi-infection rates except for winter 2017; therefore, all nymphs may contribute to T. cruzi-transmission to humans. Assessment of infection using two samples represents a realistic way to determine the infection a triatomine can harbor. The underlying mechanism may be that some bugs do not excrete parasites unless they are fed and maintained for some time under environmentally controlled conditions before releasing T. cruzi, which persists in the vector hindgut. We suggest that T. cruzi-infection dynamics regarding the three types of positive-PCR results detected by follow-up represent: residual T. cruzi in the rectal lumen (+/-), colonization of parasites attached to the rectal wall (-/+), and presence of both kinds of flagellates in the hindgut of triatomines (+/+). We suggest residual T. cruzi-infections are released after feeding, and result 60–90 days after infection persisting in the rectal lumen after a fasting event, a phenomenon that might vary between contrasting seasons and years.

show abstract

“…The period of time before the death of either third and fourth instar nymphs or adults of M. spinolai from the field is unaffected by the infection after feeding two times on uninfected mice before starvation. 127 However, after an infection of fifth instar nymphs of T. pallidipennis , the starvation capacity is reduced. 64 In experimental infections of first instar nymphs of T. infestans , followed by either one, two or three additional uninfected blood feedings to the subsequent nymphal instars on hens, the mean periods of survival of the resulting fourth and fifth instar nymphs are, respectively, 14 and 17% significantly shorter than those of uninfected nymphs.…”

Section: Effects Of T Cruzi On Triatominesmentioning

confidence: 99%

An Update on the Knowledge of Parasite–Vector Interactions of Chagas Disease

Schaub¹

2021

RRTM

View full text Add to dashboard Cite

This review focusses on the interactions between the etiologic agent of Chagas disease, Trypanosoma cruzi , and its triatomine vector. The flagellate mainly colonizes the intestinal tract of the insect. The effect of triatomines on trypanosomes is indicated by susceptibility and refractoriness phenomena that vary according to the combination of the strains. Other effects are apparent in the different regions of the gut. In the stomach, the majority of ingested blood trypomastigotes are killed while the remaining transform to round stages. In the small intestine, these develop into epimastigotes, the main replicative stage. In the rectum, the population density is the highest and is where the infectious stage develops, the metacyclic trypomastigote. In all regions of the gut, starvation and feeding of the triatomine affect T. cruzi . In the small intestine and rectum, starvation reduces the population density and more spheromastigotes develop. In the rectum, feeding after short-term starvation induces metacyclogenesis and after long-term starvation the development of specific cells, containing several nuclei, kinetoplasts and flagella. When considering the effects of T. cruzi on triatomines, the flagellate seems to be of low pathogenicity. However, during stressful periods, which are normal in natural populations, effects occur often on the behaviour, eg, in readiness to approach the host, the period of time before defecation, dispersal and aggregation. In nymphs, the duration of the different instars and the mortality rates increase, but this seems to be induced by repeated infections or blood quality by the feeding on infected hosts. Starvation resistance is often reduced by infection. Longevity and reproduction of adults is reduced, but only after infection with some strains of T. cruzi . Only components of the surface coat of blood trypomastigotes induce an immune reaction. However, this seems to act against gut bacteria and favours the development of T. cruzi.

show abstract

Survivorship of wild caught Mepraia spinolai nymphs: The effect of seasonality and Trypanosoma cruzi infection after feeding and fasting in the laboratory

Cited by 13 publications

References 32 publications

Trypanosoma cruzi-infected triatomines and rodents co-occur in a coastal island of northern Chile

Trypanosoma cruzi-infected triatomines and rodents co-occur in a coastal island of northern Chile

Trypanosoma cruzi infection follow-up in a sylvatic vector of Chagas disease: Comparing early and late stage nymphs

An Update on the Knowledge of Parasite–Vector Interactions of Chagas Disease

Contact Info

Product

Resources

About