Síndrome de Lesch-Nyhan y automutilación oral. Reporte de un caso

González, Andrés Campolo; Diaz, Alex; Riesco, Daniel Alejandro Fontboté; Chávez, Marta Hernández

doi:10.4067/s0370-41062018000100086

Cited by 15 publications

(4 citation statements)

References 20 publications

(30 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…25 Tongue dystonia has also been reported as a symptom of other disorders, including Wilson’s disease, Lesch-Nyhan syndrome, and stroke, although in many patients it appears to be idiopathic. 23–25,29–31…”

Section: Discussionmentioning

confidence: 99%

Childhood-Onset Spinocerebellar Ataxia 3: Tongue Dystonia as an Early Manifestation

Mitchell

LaTouche

Nelson

et al. 2019

Tremor and Other Hyperkinetic Movements

View full text Add to dashboard Cite

BackgroundDystonia is a relatively common feature of spinocerebellar ataxia 3 (SCA3). Childhood onset of SCA3 is rare and typically associated with either relatively large, or homozygous, CAG repeat expansions.Case reportWe describe a 10-year-old girl with SCA3, who presented with tongue dystonia in addition to limb dystonia and gait ataxia due to a heterozygous expansion of 84 repeats in ATXN3.DiscussionDiagnosis of the SCAs can be challenging, and even more so in children. Tongue dystonia has not previously been documented in SCA3.

show abstract

Section: Discussionmentioning

confidence: 99%

Childhood-Onset Spinocerebellar Ataxia 3: Tongue Dystonia as an Early Manifestation

Mitchell

LaTouche

Nelson

et al. 2019

Tremor and Other Hyperkinetic Movements

View full text Add to dashboard Cite

show abstract

“…Males are generally affected, and heterozygous females are carriers (usually asymptomatic) (García and Torres 2010). Uric acid overproduction and urate nephropathy in this disease can be combined with neurologic impairment (Campolo González et al 2018), which leads to three overlapping clinical phenotypes: (1) the classical form of Lesch-Nyhan disease, characterized by cognitive impairment, dystonia, choreoathetosis, spasticity, self-injurious behavior, and urate nephropathy; (2) an intermediate phenotype with hyperuricemia and variable neurological manifestations with no self-injurious behavior; and (3) hyperuricemia alone (Harris 2018). The basic principles of therapy include the prevention and treatment of urolithiasis and gout (in adults) and the correction of neurological manifestations.…”

Section: Introductionmentioning

confidence: 99%

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Kalmykov¹,

Kusov²,

Yablonskaia³

et al. 2018

RRP

View full text Add to dashboard Cite

Citation: Kalmykov VA, Kusov PA, Yablonskaia MI, Korshunov EN, Korshunova DS, Kubekina MV, Silaeva YYu, Deykin AV, Lukyanov NE (2018) New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy. AbstractIntroduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study:Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCG-GTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results:A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRIS-PR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F 2 have already been received from this mating. Discussion:During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion:In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

show abstract

“…Magnetic resonance imaging (MRI) in patients with LNS showed reduction in intracranial volume, especially in the basal ganglia and frontotemporal and limbic regions and white matter reduction (2,3). The classic form was associated with reduced volume in the ventral striatum and prefrontal areas (2,7).…”

mentioning

confidence: 99%

The Role of Video-EEG Monitoring in Lesch-Nyhan Syndrome

ROZA,

BALOI,

PLAIASU

et al. 2023

Maedica

View full text Add to dashboard Cite

Introduction: Lesch-Nyhan syndrome (LNS) is a rare genetic disease secondary to a HPRT1 mutation on chromosome X. It is characterized by dystonia, developmental delay, hyperuricemia and self-harming behaviours. The HPRT enzyme is implicated in the purine salvage pathway. The deficiency of HPRT results in accumulation of uric acid. There have been some cases associated with epilepsy, but it still remains a rare occurrence in LNS patients.Case presentation: We describe the case of a 20-month-old male patient with a heterozygous HPRT1 mutation c11_17del.p (Arg4Leufs*4) associated with LNS. The child associated epileptic seizures mistaken by his parents as non-epileptic sleep events associated with apnea. Seizures were discovered secondary to a polygraphic long-time sleep video-electroencephalography (EEG) monitoring. The dystonic movements and epileptic seizures responded to Levetiracetam, but the management of the behavioural disorder remained a challenge.Conclusions: Lesch-Nyhan syndrome is a rare inherited metabolic disease and its pathogenesis is not fully known, which makes the treatment management very difficult. Despite the fact that epilepsy is uncommon in LNS children, it should always be considered as part of the differential diagnosis in movement disorders. Therefore, long-term video-EEG monitoring is recommended as well as a detailed patient history to identify possible clinical/subclinical epileptic seizures that require treatment.

show abstract

Síndrome de Lesch-Nyhan y automutilación oral. Reporte de un caso

Abstract: Although LNS is rare, it is essential to know how to proceed in order to provide the best quality of life for patients and their families. Early tooth extractions, as an initial phase in severe cases, seem to be the most useful alternative to minimize damage.

Cited by 15 publications

References 20 publications

Childhood-Onset Spinocerebellar Ataxia 3: Tongue Dystonia as an Early Manifestation

Childhood-Onset Spinocerebellar Ataxia 3: Tongue Dystonia as an Early Manifestation

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

The Role of Video-EEG Monitoring in Lesch-Nyhan Syndrome

Contact Info

Product

Resources

About