No abstract

Kruppel like factor 2 (KLF2) is a mechanosensitive transcription factor participating in the regulation of vascular endothelial cells metabolism. Activating KLF2 in endothelial cells induces eNOS (endothelial nitric oxide synthase) expression, subsequent NO (nitric oxide) release, and vasodilatory effect. In addition, many KLF2-regulated genes participate in the anti-thrombotic, antioxidant, and anti-inflammatory activities, thereby preventing atherosclerosis development and progression. In this review, we summarise recent evidence suggesting that KLF2 plays a major role in regulating atheroprotective effects in endothelial cells. We also discuss several recently identified repurposed drugs and natural plant-based bioactive compounds with KLF2-mediated atheroprotective activities. Herein, we present a comprehensive overview of the role of KLF2 in atherosclerosis and as a pharmacological target for different drugs and natural compounds and highlight the potential application of these phytochemicals for the treatment of atherosclerosis.

The vascular endothelial growth factor (VEGF) family, the crucial regulator of angiogenesis, lymphangiogenesis, lipid metabolism and inflammation, is involved in the development of atherosclerosis and further CVDs (cardiovascular diseases). This review discusses the general regulation and functions of VEGFs, their role in lipid metabolism and atherosclerosis development and progression. These functions present the great potential of applying the VEGF family as a target in the treatment of atherosclerosis and related CVDs. In addition, we discuss several modern anti-atherosclerosis VEGFs-targeted experimental procedures, drugs and natural compounds, which could significantly improve the efficiency of atherosclerosis and related CVDs’ treatment.

Cardiovascular diseases (CVD) are one of the leading causes of morbidity and mortality worldwide. mtDNA (mitochondrial DNA) mutations are known to participate in the development and progression of some CVD. Moreover, specific types of mitochondria-mediated CVD have been discovered, such as MIEH (maternally inherited essential hypertension) and maternally inherited CHD (coronary heart disease). Maternally inherited mitochondrial CVD is caused by certain mutations in the mtDNA, which encode structural mitochondrial proteins and mitochondrial tRNA. In this review, we focus on recently identified mtDNA mutations associated with CVD (coronary artery disease and hypertension). Additionally, new data suggest the role of mtDNA mutations in Brugada syndrome and ischemic stroke, which before were considered only as a result of mutations in nuclear genes. Moreover, we discuss the molecular mechanisms of mtDNA involvement in the development of the disease.

Cardiovascular diseases (CVDs) are the leading cause of death globally, representing approximately 32% of all deaths worldwide. Molecular chaperones are involved in heart protection against stresses and age-mediated accumulation of toxic misfolded proteins by regulation of the protein synthesis/degradation balance and refolding of misfolded proteins, thus supporting the high metabolic demand of the heart cells. Heat shock protein 90 (HSP90) is one of the main cardioprotective chaperones, represented by cytosolic HSP90a and HSP90b, mitochondrial TRAP1 and ER-localised Grp94 isoforms. Currently, the main way to study the functional role of HSPs is the application of HSP inhibitors, which could have a different way of action. In this review, we discussed the recently investigated role of HSP90 proteins in cardioprotection, atherosclerosis, CVDs development and the involvements of HSP90 clients in the activation of different molecular pathways and signalling mechanisms, related to heart ageing.

For more than a decade, atherosclerosis has been one of the leading causes of death in developed countries. The issue of treatment and prevention of the disease is especially acute. Despite the huge amount of basic and clinical research, a significant number of gaps remain in our understanding of the pathogenesis of atherosclerosis, and only their closure will bring us closer to understanding the causes of the disease at the cellular and molecular levels and, accordingly, to the development of an effective treatment. One of the seemingly well-studied elements of atherogenesis is the mTOR signaling pathway. However, more and more new details are still being clarified. Therapeutic strategies associated with rapamycin have worked well in a number of different diseases, and there is every reason to believe that targeting components of the mTOR pathway may pay off in atherosclerosis as well.

Citation: Kalmykov VA, Kusov PA, Yablonskaia MI, Korshunov EN, Korshunova DS, Kubekina MV, Silaeva YYu, Deykin AV, Lukyanov NE (2018) New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy. AbstractIntroduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study:Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCG-GTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results:A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRIS-PR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F 2 have already been received from this mating. Discussion:During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion:In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

Atherosclerosis is the cause of the development of serious cardiovascular disorders, leading to disability and death. Numerous processes are involved in the pathogenesis of atherosclerosis, including inflammation, endothelial dysfunction, oxidative stress, and lipid metabolism disorders. Reverse transport of cholesterol is a mechanism presumably underlying the atheroprotective effect of high-density lipoprotein. In this review, we examined disorders of cholesterol metabolism and their possible effect on atherogenesis. We paid special attention to the reverse transport of cholesterol. Transformed cholesterol metabolism results in dyslipidemia and early atherosclerosis. Reverse cholesterol transport is an endogenous mechanism by which cells export cholesterol and maintain homeostasis. It is known that one of the main factors leading to the formation of atherosclerotic plaques on the walls of blood vessels are multiple modifications of low-density lipoprotein, and the formation of foam cells following them.