Serum growth factor regulation of the paired-box transcription factor Pax-3 in neuronal cells

Evans, J. C.; Lillycrop, Karen A.

doi:10.1016/s0304-3940(96)13246-8

Cited by 7 publications

(6 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This observation is supported by similar findings from studies in cell lines which have demonstrated that growth factors, including FGF2, can induce Pax-3 mRNA expression (Pruitt, 1994;Evans and Lillycrop, 1996). It is possible that subsequent generation of neurons by treatment with LIF may also regulate transcription of Pax-3.…”

Section: Discussionsupporting

confidence: 65%

Pax-3 regulates neurogenesis in neural crest-derived precursor cells

et al. 1999

View full text Add to dashboard Cite

The peripheral nervous system consists of multiple neural lineages derived from the neural crest (NC). Pax-3 is expressed in the NC and when mutated in the splotch mouse (Sp) results in the loss of derivatives from this precursor cell population. We have investigated the role of Pax-3 in regulating the generation of neurons from NC-derived precursor cells in vitro. Pax-3 mRNA in NC cultures is initially expressed in all NC but is subsequently only retained in neurons, suggesting a role in their generation. To determine whether Pax-3 is involved in neuron development, we first examined the generation of sensory-like neurons in NC cultures from Sp mice. Fivefold less sensory-like neurons were generated in NC cultures from Sp homozygous mice as compared to wild-type littermates. The role of Pax-3 in sensory neuron generation was then directly examined in dorsal root ganglia cultures by down-regulating the expression of Pax-3 protein with antisense oligonucleotides. It was found that antisense oligonucleotides inhibited 80-90% of newly generated sensory neurons; however, there was no significant effect on the survival of sensory neurons or the precursor population. These results suggest that Pax-3 has a role in regulating the differentiation of peripheral neurons.

show abstract

Section: Discussionsupporting

confidence: 65%

Pax-3 regulates neurogenesis in neural crest-derived precursor cells

et al. 1999

View full text Add to dashboard Cite

show abstract

“…As s h o w in Fig I, hgh levels of Pa-3 bmdmg activity were observed in the nucleus of the mitotically active ND7 cells [9]. In umstrast no evidence of Pax-3 binding could be detected within the cytoplasm of these cells.…”

Section: ') M Md (5' G a G A N C G G T C C C G C~c~) Dna Mcgmtan Seqmentioning

confidence: 66%

Regulation of the paired box transcription factor Pax-3

Reeves

Harris

Lillycrop

1998

Biochemical Society Transactions

View full text Add to dashboard Cite

East, southempon SO16 7PX, UK.Par-3 is a member of the prund box (Pax) family of transcripbon factors [ 1). members of which have been shown to play key roles in early emtnyogmesis. Expression of Par4 is first detected in mice on embryonic day 8.5. Expression is akmed within the muscle parnsacellsand within the developing brain and spud cord [2). A variety of W l y arxlning mutations have been found within the Pa-3 gene in both mice and humans. Mucations in the human PAX-3 murine Pa-3 p to the splutcb phenatype[4). Homozygous sproJch mice die atwnd embryonic day 14 with multiple developnental defects incldmg spud bifida, exemqMy, a lack of rnusculatm and All members of the P a gene family contain an evolutionary consewed DNA binding domain of 128 aa, called the paired box, which was first identified in the poduct of the Drosophila paired gene. Pax-3 also Contains a seoond DNA binding Qmain, a paired type- ' . In v i h~ Par-3 binds to the eS sequence which contains an upstream A'ITA motif recognised by the homeoQmai n and adownstream G'ITC sequencerecognised by the paireddomain IS). Pa-3 in vivo can bind through the paired domain to the sequence GGTCC located within the pmnater ofthe c-MET gene [6].There is now inmasing evidence that the import of traasriphm fadas into the n u c h isnota constitutive process, instead it appears tobemodukdinrespolrsetoextemalstimuli. Recent tepartsof such regulation have shown that the &pho@mylation of transcriflon factors can unmask their nuclear localisation signal or that cytoplasmic retention of a transriphon factor occurs by vittue of its interaction with an ancharing protein [7]. To investigate whethex the bcdisation of Par-3 is regdated by similar mechansims, we have analysed the bmdmg activity of Par-3 in both nuclear and cytoplasmic extrac% of the neuronal cell line, ND7, h c h expresses high levels of Pax-3. Electrophoretc Mobility Shift Assays (EMSA) were used to study the binding of Par4 to the e5 and met recognition sequences.Nuclear and cytoplasmic extracts were prepared by the methad of Dignam et al., [S] gene gives rise to WaadehQS syndrcnne [3] and disruption of the pigmenmtirndef&.Cytoplasm Nuclear e5 met e5 met Fig 1 EMSA wng the eS (S'CTCAGCACCGCACGATTAGCACCGTTCCGCTTC 3') M md (5' G

show abstract

Section: Introductionmentioning

confidence: 99%

“…It is necessary for normal neurogenesis and myogenesis as seen in the abnormal tissue phenotypes within the Splotch mouse mutant and Waardenburg's syndrome in humans (Waardenburg, 1951;Auerbach, 1954;Epstein et al, 1991;Tassabehji et al, 1993). Pax3 has been functionally associated with the events of cellular proliferation, differentiation, positional identity, and migration (Epstein et al, 1993;Evans and Lillycrop, 1996;Maroto et al, 1997;Baker and Bronner-Fraser, 2000;Mayanil et al, 2001;Streit, 2004;Wu et al, 2008;Collins et al, 2009). For us, it was intriguing that Pax3 misexpression in cranial ectoderm could cause cells to up-regulate some early opV placodal markers, but not be sufficient for cellular delamination and neuronal differentiation (Dude et al, 2009).…”

Section: Introductionmentioning

confidence: 99%

Pax3 isoforms in sensory neurogenesis: Expression and function in the ophthalmic trigeminal placode

Adams

Sudweeks

Stark

2014

Developmental Dynamics

View full text Add to dashboard Cite

Background In the trigeminal placode, Pax3 is classified as necessary but not sufficient for sensory neuron differentiation. One hypothesis is that different Pax3 isoforms regulate cellular differentiation uniquely. Pax3 is known to sometimes activate and sometimes repress gene transcription, and its activity can be dependent on the isoforms present. Pax3 isoforms had not previously been characterized in chick sensory neurogenesis. Results RT-PCR analysis revealed three well-expressed Pax3 splice variants: Full-length (flPax3), Pax3V1 and Pax3V2. Each was characterized for its effect on neurogenesis by misexpression in placodal ectoderm. The differences observed were more apparent under conditions of enhanced neurogenesis (via Notch inhibition), where flPax3 and Pax3V1 caused failed differentiation, while Pax3V2 misexpression resembled the neuronal differentiation seen in controls. qPCR analysis revealed a progressive increase in Pax3 expression, but no significant change in relative isoform expression. Interestingly, Notch inhibition led to a significant increase in Pax3 expression. Conclusions We can conclude that: 1) flPax3 and Pax3V1 inhibit neuronal differentiation; 2) Pax3V2 is permissive for neuronal differentiation; 3) while absolute levels change over time, relative splice form expression levels are largely maintained in the trigeminal placode domain; and 4) Pax3 expression generally increases in response to Notch inhibition.

show abstract

Serum growth factor regulation of the paired-box transcription factor Pax-3 in neuronal cells

Cited by 7 publications

References 7 publications

Pax-3 regulates neurogenesis in neural crest-derived precursor cells

Pax-3 regulates neurogenesis in neural crest-derived precursor cells

Regulation of the paired box transcription factor Pax-3

Pax3 isoforms in sensory neurogenesis: Expression and function in the ophthalmic trigeminal placode

Contact Info

Product

Resources

About