The function of the low-affinity nerve growth factor (NGF) receptor, p75NGFR, in regulating neuronal survival during development is unclear. The sensory deficit in mice with mutated p75NGR suggests it is necesary for development ofsensory neurons; however, whether it is required, in addition to trkA, for signal transduction or is more involved in localization of NGF is unresolved. In Survival was assessed by counting viable neurons in individual Terasaki wells at the start (3 hr after plating) and end of the experiments (usually at 48-60 hr after plating). Neuronal survival was determined by the phase-microscopic criteria of neuronal morphology, phase-brightness, cytoplasmic integrity, and nongranularity. To establish accuracy of the counting procedure, counts were initially performed "blind" by the experienced cell counters, in almost all cases with close agreement in results. This comparison of counts by different observers was repeated periodically to ensure that accuracy was maintained. In experiments using NGF, the NGF was added at the time of plating. When oligonucleotides were used, they were briefly mixed and triturated with the cells immediately prior to plating and were included in the plating medium.Antisense Oigonucleotides. Oligonucleotides were synthesized on an automatic synthesizer (Applied Biosystems 380B) and sulfurized to the phosphorothioate form with tetraethylthiuram disulfide. They were purified by reverse-phase HPLC, eluted in acetonitrile, lyophilized and reconstituted in H20 twice to remove volatile contaminants, and then further purified by Sephadex G-25 gel filtration. 18-mer or 19-mer phosphorothioate oligonucleotides were used in most cases, and the sequences chosen were directed against the 3' end of the coding region [based on a previous p75NP0R antisense study (4)] and against a region spanning the initiation codon at the 5' end. Scrambled (nonsense) and sense oligonucleotides were used as controls. Sequences used were as follows (all sequences are written 5' -+ 3'): rat 3' antisense, AGTG-GACTCGCTGCATAG; rat 3' sense, CTATGCAGC-GAGTCCACT; rat 5' antisense, ACCTGCCCTCCTCAT-TGCA; rat 5' nonsense, CTCCCACTCGTCATTCGAC; chicken 3' antisense, GGTGGACTCGCTGTACAG (15/18 homology with corresponding rat sequence); and an unrelated nonsense sequence, TCTTCTTCAAGCTTTGGC. A 26-mer antisense sequence to rat p75NGFR, based on the 5' region (CATTGCACGCCTCCGGCGTCAGCGCT), was tried in separate experiments and found to be effective but less so than the smaller antisense oligonucleotides described above. Most ofthe oligonucleotides used were obtained from more than one synthesis over the duration of the experiments, and in each case the effect of the oligonucleotide was maintained over separate syntheses. Immun g. Although the majority of survival assays were performed in mouse cells, rat cells were used for immunostaining as the monoclonal antibody (MC192, Boehringer Mannheim) does not detect mouse p75NOFR (5). Singlecell suspensions of P2 rat DRG cells were prepared as described above, ...

No abstract

No abstract

Although brain-derived neurotrophic factor (BDNF) has been shown to promote peripheral myelination during development and remyelination after injury, the precise mechanisms mediating this effect remain unknown. Here, we determine that BDNF promotes myelination of nerve growth factor-dependent neurons, an effect dependent on neuronal expression of the p75 neurotrophin receptor, whereas BDNF inhibits myelination of BDNF-dependent neurons via the full-length TrkB receptor. Thus, BDNF exerts contrasting effects on Schwann cell myelination, depending on the complement of BDNF receptors that are expressed by different subpopulations of dorsal root ganglion neurons. These results demonstrate that BDNF exerts contrasting modulatory roles in peripheral nervous system myelination, and that its mechanism of action is acutely regulated and specifically targeted to neurons.

The p75 low affinity neurotrophin receptor (p75) can induce apoptosis in various neuronal and glial cell types. Because p75 is expressed in the cholinergic neurons of the basal forebrain, p75 knockout mice may be expected to show an increased number of neurons in this region. Previous studies, however, have produced conflicting results, suggesting that genetic background and choice of control mice are critical. To try to clarify the conflicting results from previous reports, we undertook a further study of the basal forebrain in p75 knockout mice, paying particular attention to the use of genetically valid controls. The genetic backgrounds of p75 knockout and control mice used in this study were identical at 95% of loci. There was a small decrease in the number of cholinergic basal forebrain neurons in p75 knockout mice at four months of age compared with controls. This difference was no longer apparent at 15 months due to a reduction in numbers in control mice between the ages of 4 and 15 months. Cholinergic cell size in the basal forebrain was markedly increased in p75 knockout mice compared with controls. Spatial learning performance was consistently better in p75 knockout mice than in controls, and did not show any deterioration with age. The results indicate that p75 exerts a negative influence on the size of cholinergic forebrain neurons, but little effect on neuronal numbers. The markedly better spatial learning suggests that the function, as well as the size, of cholinergic neurons is negatively modulated by p75.