Mutations in the murine Pax-3 gene lead to a range of developmental abnormalities including deficiencies in sensory and sympathetic neurones. We have investigated Pax-3 expression during neuronal differentiation and show levels of Pax-3 DNA binding decrease upon cell cycle arrest and morphological differentiation. The fall in Pax-3 DNA binding occurs within 1 h of the induction of differentiation and is mediated in part by a decrease in Pax-3 mRNA. This decrease in Pax-3 binding activity precedes any changes in cell proliferation or morphology, suggesting that the downregulation of this transcription factor may be an important prerequisite for the differentiation of neuronal progenitor cells.z 1998 Federation of European Biochemical Societies.
East, southempon SO16 7PX, UK.Par-3 is a member of the prund box (Pax) family of transcripbon factors [ 1). members of which have been shown to play key roles in early emtnyogmesis. Expression of Par4 is first detected in mice on embryonic day 8.5. Expression is akmed within the muscle parnsacellsand within the developing brain and spud cord [2). A variety of W l y arxlning mutations have been found within the Pa-3 gene in both mice and humans. Mucations in the human PAX-3 murine Pa-3 p to the splutcb phenatype[4). Homozygous sproJch mice die atwnd embryonic day 14 with multiple developnental defects incldmg spud bifida, exemqMy, a lack of rnusculatm and All members of the P a gene family contain an evolutionary consewed DNA binding domain of 128 aa, called the paired box, which was first identified in the poduct of the Drosophila paired gene. Pax-3 also Contains a seoond DNA binding Qmain, a paired type- ' . In v i h~ Par-3 binds to the eS sequence which contains an upstream A'ITA motif recognised by the homeoQmai n and adownstream G'ITC sequencerecognised by the paireddomain IS). Pa-3 in vivo can bind through the paired domain to the sequence GGTCC located within the pmnater ofthe c-MET gene [6].There is now inmasing evidence that the import of traasriphm fadas into the n u c h isnota constitutive process, instead it appears tobemodukdinrespolrsetoextemalstimuli. Recent tepartsof such regulation have shown that the &pho@mylation of transcriflon factors can unmask their nuclear localisation signal or that cytoplasmic retention of a transriphon factor occurs by vittue of its interaction with an ancharing protein [7]. To investigate whethex the bcdisation of Par-3 is regdated by similar mechansims, we have analysed the bmdmg activity of Par-3 in both nuclear and cytoplasmic extrac% of the neuronal cell line, ND7, h c h expresses high levels of Pax-3. Electrophoretc Mobility Shift Assays (EMSA) were used to study the binding of Par4 to the e5 and met recognition sequences.Nuclear and cytoplasmic extracts were prepared by the methad of Dignam et al., [S] gene gives rise to WaadehQS syndrcnne [3] and disruption of the pigmenmtirndef&.Cytoplasm Nuclear e5 met e5 met Fig 1 EMSA wng the eS (S'CTCAGCACCGCACGATTAGCACCGTTCCGCTTC 3') M md (5' G
Mutations within the Pax-3 gene lead to a range of developmental abnormalities in both humans and mice. In this report, we have investigated the role that Pax-3 plays in neuronal cell development by specifically downregulating Pax-3 expression within a neuronal cell line. This was achieved by stably transfecting the neuronal cell line ND7 with an expression vector in which antisense Pax-3 RNA was produced under the control of the inducible MMTV promoter. In the stable transfectants, we found that the addition of dexamethasone led to the induction of antisense Pax-3 RNA and a rapid downregulation in endogenous Pax-3 protein expression. The decrease in endogenous Pax-3 protein expression corresponded with a dramatic change in the morphology of the cell: the normally rounded ND7 cells exhibited increased cell to substrate adhesion, extended long neurite processes and expressed genes such as snap-25 that are characteristic of a mature neuron. The morphological differentiation induced by a reduction in Pax-3 expression was followed 24–48 hours later by a cessation in cell proliferation. Interestingly the morphological differentiation and cessation in cell proliferation inducted in the cell lines lacking Pax-3 could be reversed by the addition of the mitogenic growth factor EGF but not by bFGF, whose receptor was downregulated in these cells. These results suggest that the expression of Pax-3 is essential to maintain the undifferentiated phenotype of these immature neuronal cells, and in its absence the cells acquire many of the characteristics of a mature neuronal cell. The slow onset of cell cycle arrest in the cells lacking Pax-3 argues against this transcription factor playing a direct role in the regulation of neuronal cell proliferation.
Pax-3 belongs to a family of nine murine transcription factors. These are highly conserved DNA-binding proteins which share a conserved DNA binding motif of 128 amino acids [I]. Pax-3 is expressed in neural crest cells, the developing spinal cord and brain from day 8.5-14pc in early murine embryonic and neural development. Expression is regulated both temporally and spatially, and occurs in mitotic cells before the onset of differentiation [2]. The cells of the neural crest are. progenitors of many neuronal and non-neuronal cell types. Loss of Pax-3 function and mutations in the gene lead to developmental abnormalities such as the splotch phenotype in mice and Waardenburgs syndrome in humans. Defects include limb deformities, changes in pigmentation, loss of hearing, exencephaly and spina bifida [2]. This indicates that Pax-3 plays a crucial regulatory role in neural development and therefore it is important to elucidate its precise role. In order to identify the effects of Pax-3, the neuronal ND7 cell line that expresses high levels of Pax-3 was used as a neural crest cell model [3]. Investigations were carried out on antisense Pax-3 ND7 cell lines obtained by transfection with antisense Pax-3 DNA.Cell lines were prepared by introducing antisense Pax-3 DNA into a mammalian vector, under the control of the inducible MMTV promotor. ND7 ceUs were stably transfected with antisense Pax-3 or vector alone [4]. Induction of antisense Pax-3 RNA was by 1pM Dexamethasone for 48hrs. To confirm a reduction in endogenous Pax-3, Electromobility shift assay (EMSA) analysis was performed. Nuclear cell extracts [5] were assayed for DNA binding by incubation with 25ng of e5 annealed oligonucleotide encoding the specific Pax-3 DNA-binding sequence labelled with ['PI. Samples were run on a 4% acrylamide, non-denaturing gel and visualised by autoradiography. Cell growth was quantified by staining cells with Trypan Blue. Cells were counted between 0 and 72 hrs post-induction on a Neubauer haemocytometer.A reduction in endogenous Pax-3, after 48hrs dexamethasone induction was shown by EMSA analysis (figure I). Pax-3 DNAbinding was greatly reduced in the antisense Pax-3 cell lines (as1 and as2), but was still present in vector only cell lines (V1 and V2). No reduction in Pax-3 was evident in uninduced cell lines.-Dexamethasone + Dexamethasone V1 V2 as1 as2 V1 V2 as1 as2
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.