Raman depolarization ratios in RNA and DNA are sensitive for sugar‐base coupling

Terpstra, P.A.; Otto, Cornelis; Segers-Nolten, Gezina M.J.; Kanger, Johannes S.; Greve, Jan

doi:10.1002/bspy.350010404

Cited by 8 publications

(5 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The overall aims of our study were to test the validity of the various DNA structural marker bands that have been reported previously in Raman spectra, and to potentially provide a new layer of structural information through the measurement of Raman depolarization ratios. Polarized RS has previously been shown to be helpful in the assignment of Raman bands to specific vibrational modes in the spectra of duplex DNA, as well as helpful for determining the orientations and conformations of nucleotide residues …”

Section: Introductionsupporting

confidence: 93%

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Friedman

Terentis

2015

J. Raman Spectrosc.

View full text Add to dashboard Cite

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)4‐3′, and a modified c‐Myc NHE‐III1 sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na+ or K+, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm−1 and 1420–1460 cm−1 spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm−1) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.

show abstract

Section: Introductionsupporting

confidence: 93%

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Friedman

Terentis

2015

J. Raman Spectrosc.

View full text Add to dashboard Cite

show abstract

“…Raman spectra of the polynucleotide at pH 7.2/low salt and pH 7.2/high salt were measured on a standard scanning spectrometer described previously (Terpstra, 1995), employing a 90°scattering geometry. The excitation wavelength is 514.5 nm from an argon ion laser using a laser power of 0.6 W. The power at the sample was increased ap-proximately 2-fold by retro-reflection of the laser beam from a spherical mirror behind the cuvette.…”

Section: Methodsmentioning

confidence: 99%

Evidence for Hoogsteen GC Base Pairs in the Proton-Induced Transition from Right-Handed to Left-Handed Poly(dG-dC)·Poly(dG-dC)

1997

Self Cite

View full text Add to dashboard Cite

The structure of double-helical poly(dG-dC)‚poly(dG-dC) is investigated at various pH values with Raman spectroscopy, absorption spectroscopy, and circular dichroism. A comparison is made between the B-form with Watson-Crick base pairing at 1 mM [Na + ] and pH 7.2, the Z-form with Watson-Crick base pairing at 4 M [Na + ] and pH 7.2, and a different structure at 1 mM [Na + ] and pH 4.5 as well as at 150 mM [Na + ] and pH 3.1. The CD spectrum of poly(dG-dC)‚poly(dG-dC) under the latter conditions does not show a negative band at 290 nm. The structure is a double-helical structure different from the B-form and the Z-form according to circular dichroism, Raman, and absorption spectroscopic studies. The Raman spectra evidence that the structure contains Hoogsteen base pairing. This can be accommodated in the double helix when the cytosine group is protonated and the sugar-guanine conformer has adopted a C 2′ -endo/syn conformation. It is shown that this antiparallel-stranded Hoogsteen base paired structure can be maintained under varying conditions, balancing the decrease in pH with an increased salt concentration. It is further concluded that the proton-induced transition from a Watson-Crick to a Hoogsteen base pair is aided by a decrease of [Na + ] at pH 4.5 and occurs prior to a conversion from a right-handed helix to a left-handed helix.The secondary structure of poly(dG-dC)‚poly(dG-dC) in aqueous solutions of low ionic strength and at physiological pH is generally recognized as a double-stranded helix with the strands connected by Watson-Crick base pairing, the so-called B-form. In a high-salt environment, it was established, by means of CD and Raman spectra, that the polynucleotide has a left-handed double-helical structure (Pohl & Jovin, 1972;Thamann et al., 1981;Benevides & Thomas, 1983).Apart from studies on effects of salt concentration, several investigations have been performed on the influence of pH on DNA conformation. Courtois et al. (1968) used optical rotatory dispersion and suggested a conformational change of guanine residues in DNA upon acid titration between pH 3 and 4. It was hypothesized as a possible interpretation of their results that upon protonation on guanine N7, guanine becomes unstacked and rotates out of the helix, reverses from the anti into the syn position, pairs in a Hoogsteen manner, and thus shares the proton with N3 on cytosine. Zimmer and Triebel (1969) concluded from spectrophotometric pHtitration measurements at 20 mM [K + ] that reversible and irreversible conformational changes occur in DNA upon acid treatment. From viscosimetric and spectrophotometric investigations on DNA at different pH values and ionic strengths, it was shown by Kas'yanenko et al. (1986) that DNA is in a double-helical form until at least pH 3.5 at 0.1 M salt concentration. Chen (1984) suggests from spectroscopic studies on the salt titration for poly(dG-dC)‚poly(dGdC) in solutions with pH 7.0 and pH 3.8 that base protonation facilitates the B to Z interconversion.The possible presence of prot...

show abstract

“…Thus vibrational bandwidths were found to be influenced by backbone dynamics, hydrogen bonding and solvent accessibility; 40 and depolarization ratios were used to monitor coupling between base vibrations and vibrations of sugar rings with different puckers. 41 Hence the flat plateau observed in the ROA couplet intensities below ca 15°C suggests, by analogy with the protein case, 42,43 that the biopolymer molecules are in metastable glass-like states in which motions between conformational substates are frozen out. In the premelting regime above the sigmoidal transition region, rapid equilibrium fluctuations take place between all conformational substates.…”

Section: Conformational Substates?mentioning

confidence: 99%

Evidence for a new transition in polyribonucleotides from raman optical activity

Bell

Hecht

Barron

1999

J. Raman Spectrosc.

View full text Add to dashboard Cite

Vibrational Raman optical activity (ROA) measurements are reported on single-stranded poly(rA) and double-stranded poly(rA)·poly(rU) in the temperature range 2 -45 • C. The intensities of one ROA couplet in poly(rA) (centred at ca 1329 cm −1 and sensitive to sugar-base conformation) and three in poly(rA)·poly(rU) (two centred at ca 1252 and 1339 cm −1 and sensitive to sugar-base conformation, and one centred at ca 1681 cm −1 and sensitive to base stacking geometry) are plotted as a function of temperature. All four plots reveal a sharp glass-like transition at ca 15 -18 • C which appears to embrace the entire biopolymer. Since both single-and double-stranded polyribonucleotides show the transition, it does not appear to be primarily associated with base-pair opening. Differential scanning calorimetry failed to reveal any latent heat, which suggests that it is not a simple first-order transition. The possibility that the transition might be associated with a freezing of motions between conformational substates, perhaps in conjuction with changes in water structure, is discussed.

show abstract

Raman depolarization ratios in RNA and DNA are sensitive for sugar‐base coupling

Cited by 8 publications

References 18 publications

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Evidence for Hoogsteen GC Base Pairs in the Proton-Induced Transition from Right-Handed to Left-Handed Poly(dG-dC)·Poly(dG-dC)

Evidence for a new transition in polyribonucleotides from raman optical activity

Contact Info

Product

Resources

About