Confocal Raman microspectroscopy (CRM) continues to develop as a promising technique with possible clinical applications for the diagnosis and treatment of skin cancers. CRM studies of single cells can provide information on the biochemical content of cancer cells in situ, potentially providing new biochemical signatures or markers of cancer cells. Here, we report a CRM study of single, living human metastatic melanoma cells (SK‐Mel‐2) and normal skin fibroblast cells (BJ) cultured and examined under identical experimental conditions. A total of almost 1200 Raman spectra were measured from more than 120 BJ and SK‐Mel‐2 cells using an inverted microscope with 647 nm laser excitation. Raman spectra were measured from within three distinct intracellular regions of the cells – cytoplasm, nucleoplasm, and nucleolus. When Raman spectra from each cell type were compared using principal components analysis (PCA) and linear discriminant analysis with leave‐one‐dish‐out cross‐validation (LDA‐CV), the two cell types were discriminated with 93% (cytoplasm), 98% (nucleolus), and 96% (nucleoplasm) accuracy. The main biochemical differences identified between the two cell types were higher RNA levels in the nucleoli of BJ cells and high amounts of lipid and collagen in the cytoplasm of SK‐Mel‐2 cells. For both cell types, higher levels of RNA were detected in the nucleoli versus the nucleoplasm. PCA with LDA‐CV was 98% (cytoplasm), 93% (nucleoplasm), and 73% (nucleolus) accurate in identifying the intracellular region based on the Raman spectra from both cell types. No significant trend was observed when the data were analyzed with respect to cell passage number. Thus, CRM with PCA and LDA‐CV successfully discriminated two skin cancer‐relevant cell lines while detecting different amounts of nucleic acids, lipids, and proteins in distinct intracellular regions, further underscoring its potential as a clinical diagnostic tool. Copyright © 2013 John Wiley & Sons, Ltd.
G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)4‐3′, and a modified c‐Myc NHE‐III1 sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na+ or K+, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm−1 and 1420–1460 cm−1 spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm−1) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.