Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Abstract

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)4‐3′, and a modified c‐Myc NHE‐III1 sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na+ or K+, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm−1 and 1420–1460 cm−1 spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm−1) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.

Recent advances in linear and non‐linear Raman spectroscopy. Part XI

“…Friedman and Terentis reported the analysis of G‐quadruplex conformations using Raman and polarized Raman spectroscopy. Their results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures . Hernandez et al demonstrated that all characteristic Raman markers of tyrosine and tyrosinate originate from phenol ring fundamental vibrations.…”

“…Their results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double-chain reversal (DCR) loop (MycL1) structures. [56] Hernandez et al demonstrated that all characteristic Raman markers of tyrosine and tyrosinate originate from phenol ring fundamental vibrations. Their Raman data collected from free amino acid and peptide chains permit assignment of the seven markers located at approximately 1,616, 1,606, 1,210, 1,178, 850, 830, and 643 cm −1 to tyrosine.…”

Does Raman spectroscopy recognize different G‐quadruplex arrangements?

“…Conventional nonresonant Raman spectroscopy was first intensively used to study G‐quadruplexes in the Thomas lab in the mid‐1990 . Later several other articles, including ours, appeared . The decisive advantage of nonresonant Raman spectroscopy is its spectral richness and the ability to study nucleic acids samples in solution over a wide range of DNA concentrations, as a function of various physicochemical factors such as temperature or ionic strength, starting at concentrations typical of NMR measurements (and still accessible by CD spectroscopy) up to very high concentrations not readily accessible by other methods .…”

“…[36][37][38][39][40][41] Later several other articles, including ours, [16] appeared. [42,43] The decisive advantage of nonresonant Raman spectroscopy is its spectral richness and the ability to study nucleic acids samples in solution over a wide FIGURE 1 Schematic sketch of the G-quadruplex structures of wt (i.e. AG 3 (T 2 AG 3 ) 3 ) in Na + [24], and ap19 [18] and ap7-13-19 in K + [19] with the positions of adenine abasic lesions (within the original sequence of wt) denoted by stars.…”

Raman Scattering: From Structural Biology to Medical Applications

“…For that experiment, Raman tensors were obtained from polarized Raman analyses of oriented specimens of EtBr (single crystal) and DNA (hydrated fiber). Polarized RS is also applied to DNA quadruplexes and telomeres identification and characterization [162].…”