Prevalence and Risk Factors ofToxoplasma gondiiin Fattening Pigs Farm from Yucatan, Mexico

Abstract

The objective of this study was to estimate the prevalence and identify risk factors associated with the presence of Toxoplasma gondii in pig-fattening farms from Yucatan, Mexico. A cross-sectional study was conducted with a two-stage sampling. There were 429 pigs sampled from 39 farms randomly selected. Blood samples were collected to obtain DNA and serum. The presence of IgM and IgG antibodies was determined by indirect ELISA. Prevalence was estimated by diagnostic test. Potential risk factors to be included in a marginal logistic regression were tested by chi-square or Fisher. The prevalence of IgM and IgG was 92.5% (397/429) (CI 89.9–95.1%) and 95.8% (411/429) (CI 93.7–97.8%), respectively. Regarding PCR, a prevalence of 50.8% (218/429) (CI 45.9–55.6%) was found. The logistic regression showed an association with herd size and type of feeder (P < 0.05). The risk of a case in farms with ≤400 pigs was 27.9 times higher than in farms with >400 pigs. The manual feeder was a significant protective factor associated with the seropositive against T. gondii. Results indicate a high circulation of T. gondii in pig-fattening farms from Yucatan, finding an increased risk of infection for those farms with less than 400 animals and automatic feeders.

Investigate the Toxoplasma gondii infection in the consumed beef in Al-Diwaniyah province

“…Conventional PCR was performed for detection T. gondii based on amplify the B1 gene, this procedure was applied according to technique explained by (5) this gene was target to produce the specific primer, as forward primer (5' AAAAATGTGGGAATGAAAGAG 3'), and revers primer (5' ACGAATCAACGGAACTGTAAT 3'), and the conditions of PCR thermo cycler (Amplification steps) included initial denaturation at 95 ºC for 5 minute, 30 cycle for denaturation at 95 ºC for 30 second, annealing at 56 ºC for 30 second, extension at 72 ºC for 30 second, 1 cycle for final extension at 72 ºC for 5 minute, the PCR products of B1 gene was analyzed by 1% agarose gel electrophoresis to detect an expect 469 bp product.…”

Mapping of the environmental contamination of Toxoplasma gondii by georeferencing isolates from chickens in an endemic area in Southeast Rio de Janeiro State, Brazil

“…Additionally, four farms where cats were present were located in non-contaminated areas and there were 15 farms without cats located in areas with environmental contamination (Table 1). The lack of an association between the presence of cats and environmental contamination has been reported for pig and sheep farms (Luciano et al, 2011;Ortega-Pacheco et al, 2013). Furthermore, a study investigating defecation sites of cats in an urban area concluded that the areas most contaminated with oocysts were not necessarily those with the largest number of cats (Afonso et al, 2008).…”

Abundance Detection and Molecular Characterization of Toxoplasma gondii by SAG1 Gene in Rodents and Cattle of Golestan Province, Northeast of Iran

“…Prevalence of 40% T. gondii antibodies in stray cats in Sari, Northern Iran, has been reported by Sharif et al They also survey anti T. gondii antibodies with latex agglutination test (LAT) on 100 serum samples collected from stray cats in five urban areas of Sari. Sari is located near Golestan province in North Iran and has humid climate which has been introduced suitable for T. gondii growth [22][23][24][25]. A study in Tabriz by Jamali clarified 36/2% T. gondii infection of cats by using dye test that differed with our methods.…”

“…In Sari by contrast, differences in T. gondii infection were detected between male stray cats and female stray cats. In 2013, Cong detected house sparrows toxoplasmosis in China, Khademvatan detected birds toxoplasmosis in southwest of Iran and Ortega found pigs toxoplasmosis in Mexico [22][23][24][25][26]. Most of the [26][27][28][29][30].…”