Polymorphism of the kinase domain of the S-locus receptor kinase gene (SRK) in Brassica oleracea L.

Nishio, Takeshi; Kusaba, Makoto; Sakamoto, Koji; Ockendon, D. J.

doi:10.1007/s001220050568

Cited by 61 publications

(45 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The specific PCR fragments all coincided with the expected length reported in the literature (Table 3), except for the PCR Nishio et al (1996), B. oleracea ATGAAAGGGGTACAGAACAT PS5 Nishio et al (1996), B. campestris ATGAAAGGCGTAAGAAAAACCTA PS15 Nishio et al (1996), B. oleracea CCGTGTTTTATTTTAAGAGAAAGAGCT PS18 Nishio et al (1996), B. campestris ATGAAAGGTGTACGAAACATCTA PS21 Nishio et al (1996), B. oleracea CTCAAGTCCCACTGCTGCGG PK1 Nishio et al (1997), B. oleracea CTGCTGATCATGTTCTGCCTCTGG PK4 Nishio et al (1997), B. oleracea CAATCCCAAAATCCGAGATCT PK5 Nishio et al (1997), B. oleracea AGACAAAAGCAAGCAAAAGCA NM1 Niikura and Matsuura (1998), B. oleracea ACAGAACACTTGTATCTCCAGG NM2 Niikura and Matsuura (1998), B. oleracea AGCCAATCTGACATAAAGATC products of PS5/PS15 and PS15/PS18. PS5/PS15 amplified a fragment of 1000 bp and PS15/PS18 a fragment of 370 bp instead of the expected PCR products of 1300 bp.…”

Section: Resultssupporting

confidence: 78%

“…These primers gave a very unspecific reaction in the study. Nishio et al (1997) could amplify class I S-specific sequences with the SRK-specific primers PK1, PK4 (derived from SRK 6 ) and PK5 (derived from SRK 2 ) but not class II S-specific sequences. Also in the present examination the primer combination PK1/PK4 amplified exclusively class I S-specific sequences present in the line 2065 and sequences of the self-compatible plants.…”

Section: Discussionmentioning

confidence: 99%

“…Brace et al (1994) were able to differentiate 48 SI B. oleracea lines using the primer pair Ôa/bÕ in combination with five different restriction enzymes with respect to different S alleles. Nishio et al (1997) distinguished 30 of 42 S haplotypes in B. oleracea using two SRK-specific primer pairs combined with four restriction enzymes. It could be very useful to characteriae as many S alleles as possible with SLG-and SRK-specific primers to provide a S locus typing tool in Brassica species for scientists and breeders.…”

Section: Discussionmentioning

confidence: 99%

“…As the SLR genes are not linked to the S locus, these workers proposed that the SLRs have a general function in pollination. Brace et al (1993Brace et al ( , 1994, Nishio et al (1996Nishio et al ( , 1997 and Park et al (2001Park et al ( , 2002 successfully used a polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) approach to distinguish different alleles in B. oleracea and B. campestris at the molecular level. All the three groups amplified PCR products of genomic DNA using primers annealing to S locus sequences.…”

mentioning

confidence: 99%

See 3 more Smart Citations

Development of a molecular CAPS marker for the self-incompatibility locus in Brassica napus and identification of different S alleles

2005

View full text Add to dashboard Cite

Using primers annealing to S locus sequences the cleaved amplified polymorphic sequences (CAPS) method was applied to develop a marker and to characterize different alleles at the self-incompatibility locus in Brassica napus. A segregating F 2 population from a cross of a self-incompatible (SI) and a self-compatible parent, as well as seven SI lines representing four different S alleles were used. Several primers specific to the S locus in B. oleracea and B. campestris, chosen from the literature, allow polymerase chain reaction (PCR) amplification of genomic DNA. However, only one primer pair amplified a single specific and reproducible PCR fragment of the expected length in B. napus. Digestion with restriction endonucleases revealed polymorphisms for two CAPS markers absolutely linked to the S locus. Using the codominant marker efMboI it was possible to discriminate all three F 2 genotypes. With this marker and an additional marker using another primer pair it was possible to distinguish between three of the four different S alleles and five of the seven SI lines, respectively.

show abstract

Section: Resultssupporting

confidence: 78%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Development of a molecular CAPS marker for the self-incompatibility locus in Brassica napus and identification of different S alleles

2005

View full text Add to dashboard Cite

show abstract

“…Genomic DNA from each plant was extracted from young leaves according to the cetyl trimethyl ammonium bromide (CTAB) method (Doyle & Doyle 1990). Primer pairs specific of class I or class II S haplotypes (Nishio et al 1996(Nishio et al , 1997 were used for primary identification of S haplotype class. New primer pairs were designed for further characterization and gene expression analysis using the Oligo 3 primer software (http://redb.croplab.org/modules/redbtools/ primer3.php).…”

Section: Methodsmentioning

confidence: 99%

Characterization of S haplotype in a new self-compatible Brassica rapa cultivar Dahuangyoucai

Zhang¹,

Ma²,

Dongmei³

et al. 2013

CZECH J GENET PLANT

View full text Add to dashboard Cite

Zhang X., Ma C., Yin D., Zhu W., Gao C., Zhang J., Fu T. (2013): Characterization of S haplotype in a new selfcompatible Brassica rapa cultivar Dahuangyoucai. Czech J. Genet. Plant Breed., 49: 157-163.The most important Brassica species, B. rapa, is naturally self-incompatible. Self-compatible mutants would be useful for dissecting the molecular mechanism of self-incompatibility (SI), a process that promotes outcrossing by recognizing and refusing self-pollens. The S haplotype in a new self-compatible B. rapa cultivar, Dahuangyoucai, was characterized for the first time in this study. Sequence analysis of the S-locus genes, SLG (S-locus glycoprotein), SRK (S-locus receptor kinase) and SCR (S-locus cysteine-rich protein) revealed that Dahuangyoucai contained S haplotype highly similar to S-f2, a non-functional class I S haplotype identified in another self-compatible B. rapa cultivar, Yellow Sarson. Mutations of MLPK (M-locus protein kinase) and non-transcription of the male determinant, SCR, were observed in this cultivar, which is similar to the situation reported in Yellow Sarson. With respect to the female determinant, SRK, no transcript was detected in Yellow Sarson but two fragments were detected in Dahuangyoucai. One fragment was highly similar to SRK-f2, but the other fragment was different from the signal factors previously identified in the SI reaction. The results suggest that Dahuangyoucai and Yellow Sarson have the same origin and a similar mechanism of self-compatibility, but diverge after mutations in SRK, SCR and MLPK. Further studying the self-compatibility of Dahuangyoucai might identify novel factors involved in the SI signalling cascade and provide new insights into the mechanisms of SI in Brassicaceae.

show abstract

Detection of resistance to acetolactate synthase inhibitors in weeds with emphasis on DNA‐based techniques: a review

Corbett

Tardif

2006

Pest Management Science

View full text Add to dashboard Cite

Resistance to herbicides inhibiting acetolactate synthase (ALS) has been increasing at a faster rate than in any other herbicide group. The great majority of these cases are due to various single-nucleotide polymorphisms in the ALS gene endowing target site resistance. Many diagnostic techniques have been devised in order to confirm resistance and help producers to adopt the best management strategies. Recent advances in DNA technologies coupled with the knowledge of sequence information have allowed the development of accurate and rapid diagnostic tests. While whole plant-based diagnostic techniques such as seedling bioassays or enzyme-based in vitro bioassays provide accurate results, they tend to be labour- and/or space-intensive and will only respond to the particular herbicides tested, making resolution of cross-resistance patterns more difficult. Successful DNA-based diagnosis of ALS inhibitor resistance has been achieved with three main techniques, (1) restriction fragment length polymorphism, (2) polymerase chain reaction amplification of specific alleles and (3) denaturing high-performance liquid chromatography. All DNA-based techniques are relatively rapid and provide clear identification of the mutations causing resistance. Resistance based on non-target mechanisms is not identified by these DNA-based methods; however, given the prevalence of target site-based ALS inhibitor resistance, this is a minor inconvenience.

show abstract

Polymorphism of the kinase domain of the S-locus receptor kinase gene (SRK) in Brassica oleracea L.

Cited by 61 publications

References 11 publications

Development of a molecular CAPS marker for the self-incompatibility locus in Brassica napus and identification of different S alleles

Development of a molecular CAPS marker for the self-incompatibility locus in Brassica napus and identification of different S alleles

Characterization of S haplotype in a new self-compatible Brassica rapa cultivar Dahuangyoucai

Detection of resistance to acetolactate synthase inhibitors in weeds with emphasis on DNA‐based techniques: a review

Contact Info

Product

Resources

About