Phylogenetic study of six species of Anopheles mosquitoes in Peninsular Malaysia based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA

Abstract

BackgroundMolecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene.MethodsMosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region.ResultsA total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation.ConclusionAnopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population.

Comparative Human Landing Catch and CDC Light Trap in Mosquito Sampling in Knowlesi Malaria Endemic Areas in Peninsula Malaysia

“…cracens, PCR was carried on targeted atITS2 gene. The ITS2 was amplified using primers ITS2A (5' TGTGAACTGCAGGACA 3') and ITS2B (5' TATGCTTAAATTCAGGGGGT 3') [11], [12]. Each reaction mixture of 50 µL contained 5 µL of mosquito DNA template, primers ITS2A and ITS2B, 0.2 µM respectively, and 25 µl 2× MyTaq Mix (Bioline, USA).…”

“…An. cracens from all localities was subjected for molecular analysis based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA [11]- [13] in order to confirm the species. Figure 3 showed that those mosquitoes were confirmed as An.…”

Molecular Characterization of Mosquitoes (Diptera: Culicidae) in Northwestern Iran by Using rDNA-ITS2

“…The molecular marker rDNA-ITS2 is used in molecular taxonomy for separating sibling species (2), in phylogeny for establishing evolutionary relationships among mosquito species (3), and in phylogeography and population genetics for assessing the geographic distribution of mosquitoes (4).…”

Using Next-Generation Sequencing for DNA Barcoding: Capturing Allelic Variation in ITS2

“…Numerous mosquito barcoding studies have used both mitochondrial and nuclear markers to distinguish species (Foley et al 2007; Paredes-Esquivel et al 2009; Puslednik et al 2012; Bourke et al 2013). ITS2 is often used in mosquito studies as its high evolutionary rate makes it useful for investigating closely related species, such as those in the Anopheles genus (Wilkerson et al 2004; Marrelli et al 2006; Walton et al 2007; Sum et al 2014). …”