Novel Multiplex PCR Assay for Characterization and Concomitant Subtyping of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus

Abstract

Staphylococcal cassette chromosome mec (SCCmec) typing is essential for understanding the molecular epidemiology of methicillin-resistant Staphylococcus aureus (MRSA). SCCmec elements are currently classified into types I to V based on the nature of the mec and ccr gene complexes, and are further classified into subtypes according to their junkyard region DNA segments. Previously described traditional SCCmec PCR typing schemes require multiple primer sets and PCR experiments, while a previously published multiplex PCR assay is limited in its ability to detect recently discovered types and subtypes such as SCCmec type V and subtypes IVa, b, c, and d. We designed new sets of SCCmec type-and subtype-unique and specific primers and developed a novel multiplex PCR assay allowing for concomitant detection of the methicillin resistance (mecA gene) (also serving as an internal control) to facilitate detection and classification of all currently described SCCmec types and subtypes I, II, III, IVa, b, c, d, and V. Our assay demonstrated 100% sensitivity and specificity in accurately characterizing 54 MRSA strains belonging to the various known SCCmec types and subtypes, when compared with previously described typing methods. Further application of our assay in 453 randomly selected local clinical isolates confirmed its feasibility and practicality. This novel assay offers a rapid, simple, and feasible method for SCCmec typing of MRSA, and may serve as a useful tool for clinicians and epidemiologists in their efforts to prevent and control infections caused by this organism.

Livestock-Associated MRSA and Its Current Evolution

“…The CC398 isolates firstly identified as carrying SCCmec type III, via the SCCmec PCR typing scheme developed by Zhang et al [57] corresponded in fact to isolates carrying SCCmec type V [58,59]. However, LA-MRSA CC398 harboring SCCmec type III was described in bovines [22] and pigs [2•] by researchers using a SCCmec PCR typing scheme developed by Kondo et al [60].…”

Prevalent Genotypes of Staphylococcus aureus Strains Isolated From Healthcare Workers in Duhok City, Kurdistan Region, Iraq

“…SCCmec typing was performed according to the previously described protocol of Zhang et al (12). The PCR was run under the following conditions: denaturation step at 94ºC for five minutes followed by 10 cycles of 94ºC for 45 seconds, 65ºC for 45 seconds, and 72ºC for 90 seconds and another 25 cycles of 94ºC for 45 seconds, 55ºC for 45 seconds, and 72ºC for 90 seconds, ending with a final extension step at 72ºC for 10 minutes and followed by a hold at 4ºC.…”

Antimicrobial, Antiviral Activity and GC-MS Analysis of Essential Oil Extracted from Achillea fragrantissima Plant Growing In Sinai Peninsula, Egypt

“…PCR assay was carried out as described by [34]. Using primers Beta-lactams gene resistant MRSA Mec A F (GTGAAGATATACCAAGTGATT) and R (GTGAAGATATACCAAGTGATT) gave 147 bp PCR product of mecA gene from strains Staphylococcus epidermidis and/also using primer Beta-lactams gene resistant for E. coli bla C (F) TGGCCAGAACTGACAGGCAAA (R) TTTCTCCTGAACGTGGCTGGC 462 [35,34]. The final PCR products were visualized using UV-trans-illuminator after electrophoresis on 1.5% agarose gel containing 50 mg/mL EtBr.…”