Normal coordinate analysis of 2?-deoxythymidine and 2?-deoxyadenosine

Letellier, R.; Ghomi, Mahmoud; Taillandier, E.

doi:10.1007/bf00254866

Cited by 16 publications

(23 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…53 The mode assignment is carried out by comparing our results with the previously reported 2′-dA mode assignments. 37,59 For (dAp) 5 , the 1660 cm −1 mode is assigned to the NH2 bend, the 1580 cm −1 mode to a ring stretch, and the 1480 cm −1 mode to mainly the C2H bend. Other observed vibrational modes are at 1410 cm −1 (C4N9 stretch), the most intense mode at 1340 cm −1 (N1C2, C5N7 stretches), the mode at 1310 cm −1 (C8N9 stretch), and the mode at 730 cm −1 (imidazole ring deformations).…”

Section: ■ Resultsmentioning

confidence: 99%

Initial Excited-State Structural Dynamics of dT and dA Oligonucleotide Homopentamers Using Resonance Raman Spectroscopy

Sasidharanpillai

Loppnow

2019

J. Phys. Chem. B

View full text Add to dashboard Cite

Photochemical damage of DNA is initiated by absorption of ultraviolet light, and the photoproducts are formed as a result of excited-state structural and electronic dynamics. We have used UV resonance Raman spectroscopy to measure the initial excited-state structural dynamics of homopentamers of adenosine monophosphate (3′-dApdApdApdApdAp-5′) and thymidine monophosphate (3′-dTpdTpdTpdTpdTp-5′) and compare them to those of the monomeric nucleobases. The resonance Raman spectra of the homopentamers are similar to those of the corresponding monomers. Initial excited-state slopes, homogeneous and inhomogeneous broadening, and other excited-state parameters were extracted by self-consistent simulation of the resonance Raman excitation profiles and absorption spectra with a time-dependent formalism and are also similar to the initial excited-state slopes and broadening in the nucleotide monomers. The lack of differences between the initial excited-state structural dynamics of the nucleotides within the pentamer and the isolated nucleobases is consistent with a model in which the formation of photochemical products in oligonucleotides and DNA is dependent on the formation of the transition-state structure within these polymers, dictated by their large-scale dynamics. These results are discussed in light of the known photochemistry of DNA and the nucleobases.

show abstract

Section: ■ Resultsmentioning

confidence: 99%

Initial Excited-State Structural Dynamics of dT and dA Oligonucleotide Homopentamers Using Resonance Raman Spectroscopy

Sasidharanpillai

Loppnow

2019

J. Phys. Chem. B

View full text Add to dashboard Cite

show abstract

“…The combination dG ring ν(C‐N) + δ(C8‐H) mode at ~1330 cm −1 is also sensitive to χ and P . The populations of syn and anti dG residues can be approximated by the relative intensities of bands at ~1325 cm −1 (dG C2′‐ endo / syn ) and ~1335 cm −1 (dG C2′‐ endo / anti ) .…”

Section: Discussionmentioning

confidence: 99%

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Friedman

Terentis

2015

J. Raman Spectrosc.

View full text Add to dashboard Cite

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)4‐3′, and a modified c‐Myc NHE‐III1 sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na+ or K+, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm−1 and 1420–1460 cm−1 spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm−1) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.

show abstract

“…Normalization to either band leads to the same result. Normal mode calculations have been performed for antiparallelstranded DNA (Letellier et al, 1987a(Letellier et al, -d, 1989). The calculated band positions are presented in Table I.…”

Section: Methodsmentioning

confidence: 99%

The hydrogen-bonding structure in parallel-stranded duplex DNA is reverse Watson-Crick

Otto

Thomas²,

Rippe

et al. 1991

Biochemistry

View full text Add to dashboard Cite

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5'-d-[(A)10TAATTTTAAATATTT]-3' (D1) and 5'-d[(T)10ATTAAAATTTATAAA]-3' (D2) in H2O and D2O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5'-d(AAATATTTAAAATTA-(T)10]-3' (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly[d(A)].poly[d(T)] and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due to changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region (1600-1700 cm-1) implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent wtih formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogenous sequence and high A,T content are observed at 843 and 1092 cm-1 in the spectra of the parallel-stranded duplex. The 843-cm-1 band is due to the presence of a sizable population of furanose rings in the C2'-endo conformation. Significant changes observed in the regions from 1150 to 1250 cm-1 and from 1340 to 1400 cm-1 in the spectra of the parallel-stranded duplex are attributed to variations in backbone torsional and glycosidic angles and base stacking.

show abstract

Normal coordinate analysis of 2?-deoxythymidine and 2?-deoxyadenosine

Cited by 16 publications

References 9 publications

Initial Excited-State Structural Dynamics of dT and dA Oligonucleotide Homopentamers Using Resonance Raman Spectroscopy

Initial Excited-State Structural Dynamics of dT and dA Oligonucleotide Homopentamers Using Resonance Raman Spectroscopy

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

The hydrogen-bonding structure in parallel-stranded duplex DNA is reverse Watson-Crick

Contact Info

Product

Resources

About