Nonradioactive detection of telomerase activity using the telomeric repeat amplification protocol

Herbert, Brittney Shea; Hochreiter, Amelia E.; Wright, Woodring E.

doi:10.1038/nprot.2006.239

Cited by 233 publications

(187 citation statements)

References 15 publications

Supporting

Mentioning

181

Contrasting

Order By: Relevance

“…6C). To more precisely gauge the level of telomerase activity in these mutants, we performed quantitative real-time TRAP following a method developed to monitor telomerase activity levels in human cells (22). As expected, we found no significant difference in telomerase activity in extracts prepared from nap57 ϩ/Ϫ plants versus those from wild-type plants.…”

Section: Resultsmentioning

confidence: 92%

See 1 more Smart Citation

Dyskerin Is a Component of the Arabidopsis Telomerase RNP Required for Telomere Maintenance

Kannan

Nelson

Shippen

2008

Molecular and Cellular Biology

View full text Add to dashboard Cite

Dyskerin binds the H/ACA box of human telomerase RNA and is a core telomerase subunit required for RNP biogenesis and enzyme function in vivo. Missense mutations in dyskerin result in dyskeratosis congenita, a complex syndrome characterized by bone marrow failure, telomerase enzyme deficiency, and progressive telomere shortening. Here we demonstrate that dyskerin also contributes to telomere maintenance in Arabidopsis thaliana. We report that both AtNAP57, the Arabidopsis dyskerin homolog, and AtTERT, the telomerase catalytic subunit, accumulate in the plant nucleolus, and AtNAP57 associates with active telomerase RNP particles in an RNA-dependent manner. Furthermore, AtNAP57 interacts in vitro with AtPOT1a, a novel component of Arabidopsis telomerase. Although a null mutation in AtNAP57 is lethal, AtNAP57, like AtTERT, is not haploinsufficient for telomere maintenance in Arabidopsis. However, introduction of an AtNAP57 allele containing a T66A mutation decreased telomerase activity in vitro, disrupted telomere length regulation on individual chromosome ends in vivo, and established a new, shorter telomere length set point. These results imply that T66A NAP57 behaves as a dominant-negative inhibitor of telomerase. We conclude that dyskerin is a conserved component of the telomerase RNP complex in higher eukaryotes that is required for maximal enzyme activity in vivo.

show abstract

Section: Resultsmentioning

confidence: 92%

“…Real-time quantitative TRAP was performed as described previously (22) but with the following modifications. A 4.8-ng/ l protein extract dilution (10.5 l), 1 l of 10 M forward primer (5Ј CACTATCGACTACGCGATCAG 3Ј), and 12.5 l Sybr Green PCR master mix (NEB) were incubated at 37°C for 45 min.…”

Section: Methodsmentioning

confidence: 99%

Dyskerin Is a Component of the Arabidopsis Telomerase RNP Required for Telomere Maintenance

Kannan

Nelson

Shippen

2008

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…16 Figures S2c and d), therefore indicating that the increased rate of telomere shortening at high oxygen tension is likely to result from increased oxidative damage and DSB under these conditions. 17,18 Growth of hMSC at 20% O 2 increases DSB generation and chromosomal instability.…”

Section: Resultsmentioning

confidence: 98%

“…Telomerase assays were performed on 5000 hMSC as described, 16 with the following modifications. In all, 2 ml of the extension reaction was added to 23 ml PCR reaction mix containing 1 Â PCR Master Mix power SYBR Green, 5 mM EGTA, 4 ng/ml Oligo ACX and 2 ng/ml Oligo TS.…”

Section: Methodsmentioning

confidence: 99%

Culture of human mesenchymal stem cells at low oxygen tension improves growth and genetic stability by activating glycolysis

et al. 2011

View full text Add to dashboard Cite

Expansion of human stem cells before cell therapy is typically performed at 20% O 2 . Growth in these pro-oxidative conditions can lead to oxidative stress and genetic instability. Here, we demonstrate that culture of human mesenchymal stem cells at lower, physiological O 2 concentrations significantly increases lifespan, limiting oxidative stress, DNA damage, telomere shortening and chromosomal aberrations. Our gene expression and bioenergetic data strongly suggest that growth at reduced oxygen tensions favors a natural metabolic state of increased glycolysis and reduced oxidative phosphorylation. We propose that this balance is disturbed at 20% O 2 , resulting in abnormally increased levels of oxidative stress. These observations indicate that bioenergetic pathways are intertwined with the control of lifespan and decisively influence the genetic stability of human primary stem cells. We conclude that stem cells for human therapy should be grown under low oxygen conditions to increase biosafety. Cell Death and Differentiation (2012) 19, 743-755; doi:10.1038/cdd.2011; published online 2 December 2011Human mesenchymal stem cells (hMSC) are being evaluated for the treatment of a large variety of pathologies, including traumatic lesions and cardiovascular and autoimmune diseases. 1,2 Although hMSC can be obtained from several tissues, they are scarce and their quantity and quality depends on a patient's clinical history, age, gender and genetic background. Most cell therapy protocols use 10-50 million hMSC per treatment, requiring expansion of extracted stem cells ex vivo for about 8 weeks before implantation. This expansion is typically performed under 'standard' non-physiological culture conditions, which among other factors expose cells to 20% O 2 , roughly 10 times the oxygen concentration encountered in their natural niches. 3,4 Previous studies have shown that exposure of mammalian cells to 20% O 2 concentrations induces DNA damage, thereby contributing decisively to cell senescence and loss of viability. [5][6][7] Conversely, culture of human stem cells over a physiological range of oxygen tensions (1-5%) improves cell growth, alters differentiation processes and extends lifespan. 8 Low oxygen tensions have also been shown to reduce the levels of double-strand breaks (DSB) and chromosomal abnormalities in several types of stem cells. 9,10 This evidence suggests that the poorly defined 'cell culture stress' can be a cause of genetic instability and therefore constitute a biological risk for cell therapy protocols. In agreement with this notion, we have found that short-term growth of hMSC at 20% O 2 significantly increases oxidative stress and DNA damage markers, DSB, chromosomal aberrations, aneuploidy and telomere shortening rates compared with cells grown at 3% O 2 . Despite these clear correlations, the mechanisms underlying the generation of genetic instability at high O 2 tension are mostly unknown.Mammalian cells have developed oxygen-sensing mechanisms to maintain cell and tissue homeostasis (reviewed...

show abstract

“…Recently, a real-time quantitative SYBR Green highsensitivity telomeric repeat amplification protocol (RQ-TRAP) for rapid quantitation of telomerase activity has been developed (8,9). This procedure may serve as an alternative for the study of telomerase regulation and its relevance to somatic cell physiology, particularly in population studies.…”

Section: Introductionmentioning

confidence: 99%

Quantitative telomerase activity in circulating human leukocytes: utility of real-time telomeric repeats amplification protocol (RQ-TRAP) in a clinical/epidemiological setting

Lança¹,

Zee²,

Rivera

et al. 2009

Clinical Chemistry and Laboratory Medicine

View full text Add to dashboard Cite

Background: There is accumulating evidence from the epidemiological field of telomere biology that telomere length plays an important role in the pathophysiology of cardiovascular disease. The RNA-dependent DNA polymerase, telomerase, is essential in regulating telomere length by acting as a reverse transcriptase. However, the relationship between telomerase activity and telomere length in cardiovascular disease is unclear. This is due, in part, to the paucity of information on the utility of a quantitative and routine assay for the determination of telomerase activity in circulating blood leukocytes. Methods: We used a validated, high-sensitive realtime quantitative telomeric repeat amplification protocol (RQ-TRAP) to determine telomerase activity in circulating blood leukocytes.Results: The present investigation demonstrated direct and reliable detection of telomerase activity of circulating blood leukocytes. Conclusion:The present investigation suggests the feasibility of using RQ-TRAP assay in routine screening of telomerase activity in blood specimens typically collected in a clinical/epidemiological setting.

show abstract

Nonradioactive detection of telomerase activity using the telomeric repeat amplification protocol

Cited by 233 publications

References 15 publications

Dyskerin Is a Component of the Arabidopsis Telomerase RNP Required for Telomere Maintenance

Dyskerin Is a Component of the Arabidopsis Telomerase RNP Required for Telomere Maintenance

Culture of human mesenchymal stem cells at low oxygen tension improves growth and genetic stability by activating glycolysis

Quantitative telomerase activity in circulating human leukocytes: utility of real-time telomeric repeats amplification protocol (RQ-TRAP) in a clinical/epidemiological setting

Contact Info

Product

Resources

About