Nanoparticle-assisted Polymerase Chain Reaction (NanoPCR): Optimization of PCR detection of Leifsonia xyli subsp. xyli by the addition of nanoparticles

Abstract

Leifsonia xyli subsp. xyli (Lxx) causes ratoon stunting disease (RSD) in sugarcane, and is one of major causes of production losses. The detection of Lxx bacteria in sugarcane is made mainly through molecular biology techniques, especially polymerase chain reaction (PCR). However, PCR presents some barriers to provide reliable results. The present work brings a Nanoparticle-assisted Polymerase Chain Reaction (NanoPCR) assay for the detection of Lxx in its latent infection on micropropagated sugarcane. This assay was based in the addition of Gold and Titanium dioxide nanoparticles to conventional PCR and evaluation of its effects. It was observed that the reactions performed with Titanium dioxide nanoparticles provided the formation of singular well-defined bands under electrophoresis, consistent with the expected molecular weight, without occurrence of non-specific bands or presenting false negatives occurrence, negative effects that were observed in the control assay. While the performed NanoPCR adding AuNP also provided the formation of well-defined bands, been able to inhibit the occurrence of false negatives, but wasn't able to eliminate the occurrence of non-specific amplifications. The results indicate that NanoPCR by the addition of Gold and Titanium dioxide nanoparticles to conventional PCR increased the detection of Lxx.

Identificação molecular de Leifsonia xyli subsp. xyli nas variedades RB 863129 e RB 92579 de cana-de-açúcar submetidas à termoterapia

“…Quanto à identificação molecular do patógeno, foram utilizados os primers LxxW.1 (5' CAGAGCACCATCGTGAAGAC 3') e LxxW.2 (5' AAGGACAAGTCCACCAAGGA 3'), específicos para Lxx. As condições de ciclagem foram: desnaturação inicial de 94ºC por 5 minutos, seguidos por 35 ciclos de desnaturação a 94ºC por 45 segundos, anelamento a 56ºC por 30 segundos, extensão de 72ºC por 60 segundos, seguidos por uma extensão final a 72°C por 10 minutos (Dantas et al, 2017).…”

The effects of silver and copper nanoparticles and selenium on Salmo trutta hatchlings

“…Some studies have been conducted on the effect of nanoelements on PCR reaction efficiency, but they mainly concern Au NPs (Cao et al, 2012) potentially together with titanium dioxide (TiO 2 ) NPs (Dantas et al, 2017), although there are also reports on nanometals in general (Pan et al, 2011). There is a lack of literature data on S. trutta , which can be a source of food for animals and humans.…”

Enhancement of PCR Sensitivity and Yield Using Thiol-modified Primers

“…Some of the organic and biological reagents used as additives include formamide 6 , dimethyl sulfoxide (DMSO) 7 , tetramethylammonium chloride 8 , and single-stranded binding protein 1 . More recently, researchers have identified numerous nanomaterials that can enhance the yield of PCR, such as silver nanoparticles 9 , gold nanoparticles 9 , 10 , magnetic nanoparticles 9 , TiO 2 nanoparticles 10 , carbon-coated silica nanoparticles 11 , and graphene-ZnO nanocomposites 12 . Nanomaterials can also improve the specificity of PCR, including gold nanoparticles 13 , poly(diallyldimethylammonium chloride)-protected gold nanoparticles 14 , dendrimers 15 , amino-modified magnetic nanoparticles 16 , and graphene oxide 17 .…”