Molecular detection of Neospora caninum from naturally infected four passeriforme birds in China

Liu, Meng-Ting; Lv, Qiu-Yan; Jiang, Wei-Xing; Li, Jianhua; Gui, Bin-Ze; Zheng, Wei; Zhu, Xingquan; Li, Guohua

doi:10.1016/j.actatropica.2019.105044

Cited by 4 publications

(1 citation statement)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The N. caninum NC-5 gene (328 bp) was amplified using PCR as previously described (26,27), and by using reaction conditions and primers (Np21: GGGTGTGCGTCCAATCCTGTAAC; NP6: CTCGCCAGTCAACCTACGTCTTCT) described previously (28). The PCR amplification reaction included 3 µl of total DNA, 12.5 µl of commercial premix PPP master mix, 0.1 µl of each PCR prime (0.1 mM) and the remaining 25 µl reaction volume was topped up with nuclease-free water.…”

Section: Dna Extraction and Pcr Amplificationmentioning

confidence: 99%

Molecular Detection of Toxoplasma gondii and Neospora caninum in Domestic Ducks in Hunan Province, China

Zheng

Yang

et al. 2021

Front. Vet. Sci.

Self Cite

View full text Add to dashboard Cite

Toxoplasma gondii and Neospora caninum are protozoan parasites that infect warm-blooded animals, and cause major economic losses in livestock industries worldwide. However, little is known about the genotypes of T. gondii and N. caninum in domestic ducks in China. Herein, brain samples from 588 domestic ducks from Hunan province in China were examined for the presence of T. gondii and N. caninum. Polymerase chain reaction (PCR) was used to detect T. gondii B1 gene and N. caninum NC-5 gene. Forty-five DNA samples (7.7%; 95% CI: 5.5–9.9) were positive for B1 gene, and two (0.3%; 95% CI: 0–0.7) were positive for NC-5 gene. The risk factors significantly associated with T. gondii infection were age and sex. The 45 samples positive for T. gondii were genotyped using multi-locus PCR-RFLP analysis and only one sample was fully genotyped as ToxoDB#9 (Chinese I). These results provide new information about the epidemiology of T. gondii and N. caninum in ducks in Hunan province in China. The data also highlight the importance of a “One Health” approach to dealing with toxoplasmosis.

show abstract

Section: Dna Extraction and Pcr Amplificationmentioning

confidence: 99%