Molecular Characterization of Geographically Different Banana bunchy top virus Isolates in India

Selvarajan, R.; Sheeba, M. M.; Balasubramanian, V.; Rajmohan, R.; Dhevi, N. Lakshmi; Sasireka, Thirunavukarasu

doi:10.1007/s13337-010-0020-1

Cited by 31 publications

(24 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Based on phylogenetic analysis of DNA-R, Karan et al [26] divided BBTV isolates into two groups such as a PIO group and South-East Asian (SEA) group. BBTV isolates from India were found to be belonging to the PIO group [6,37,41]. Similarly, Amin et al [3] characterized the Pakistan (Sindh) isolate of BBTV by analyzing of sequences of DNA components and indicated that BBTV present in Pakistan belongs to the PIO group.…”

Section: Introductionmentioning

confidence: 99%

Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates

et al. 2016

View full text Add to dashboard Cite

Bunchy top disease of banana caused by Banana bunchy top virus (BBTV, genus Babuvirus family Nanoviridae) is one of the most important constraints in production of banana in the different parts of the world. Six genomic DNA components of BBTV isolate from Kandy, Sri Lanka (BBTV-K) were amplified by polymerase chain reaction (PCR) with specific primers using total DNA extracted from banana tissues showing typical symptoms of bunchy top disease. The amplicons were of expected size of 1.0-1.1 kb, which were cloned and sequenced. Analysis of sequence data revealed the presence of six DNA components; DNA-R, DNA-U3, DNA-S, DNA-N, DNA-M and DNA-C for Sri Lanka isolate. Comparisons of sequence data of DNA components followed by the phylogenetic analysis, grouped Sri Lanka-(Kandy) isolate in the Pacific Indian Oceans (PIO) group. Sri Lanka-(Kandy) isolate of BBTV is classified a new member of PIO group based on analysis of six components of the virus.

show abstract

Section: Introductionmentioning

confidence: 99%

Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates

et al. 2016

View full text Add to dashboard Cite

show abstract

“…In Tamil Nadu India, the hill bananas and Sirumalai AAB-(G.I 126] were grown in multitier system (Figure 1) was highly susceptible to BBTV (Figure 2). The virus has been the main cause for drastic reduction in hill banana cultivation from 18,000 ha in 1970's to 2,000 ha at present and showed the incidence of 14-74% percentage (Kesavamoorthy, 1980;Selvarajan et al, 2010;Elayabalan et al, 2013). Vishnoi et al (2009) reported that BBTD incidence occurred between 20-30% between 2006 to 2007 in India northern zones of Lucknow, Barabanki, Bahraich, Kanpur, and Etawah districts of Uttar Pradesh.…”

Section: Bbtd Was Introduced In Sri Lanka In 1913 Andmentioning

confidence: 99%

Banana bunchy top disease (BBTD) symptom expression in banana and strategies for transgenic resistance: A review

Elayabalan

Subramaniam

Selvarajan

2015

Emir. J. Food Agric

View full text Add to dashboard Cite

Bananas are one among the world's leading food crops after rice, wheat and maize. Banana cultivation is affected by various diseases. Among them, in globally banana bunchy top disease (BBTD) caused by the banana bunchy top virus (BBTV) and Fusarium wilt caused by the Fusarium oxysporum f.sp. cubense are the most serious diseases. BBTV is an isometric virus with a circular single stranded DNA (ssDNA) genome consisting of at least six components, BBTV DNA-1 to 6. The virus is transmitted by the banana aphid (Pentalonia nigronervosa). In this review paper, we are discussing the global status of BBTD, symptom expression in both vegetative and reproductive stage, resistant strategy and recent BBTV resistant banana clones development.

show abstract

“…Amplification was performed in a 25 μl reaction mixture containing 2.5 μl of 10X PCR buffer containing 15 mM MgCl 2 , 2.0 μl of 10 mM dNTPs, 1.0 μl of 10 μM each of coat protein (CP) gene forward (5′ ATGGCTAGGTATCCGAAGAAATCC3′) and reverse (5′ TCAAACATGATATGTAATTCTGTC 3′) primers (Selvarajan et al 2010b), 1.25 U Taq DNA polymerase (Sigma,USA) and 1.0 μl of NA extract. The amplification was carried out using Master Cycler gradient (Eppendorf, Germany) and the PCR conditions were as described by Selvarajan et al (2010b).…”

mentioning

confidence: 99%

“…The amplification was carried out using Master Cycler gradient (Eppendorf, Germany) and the PCR conditions were as described by Selvarajan et al (2010b). The amplified products were resolved in 1.5 % agarose (1 × TBE) gels and electrophoresed at 100 V for 1 h. The gels were visualized and documented using Alpha Imager (Alpha Innotech Corp., USA).…”

mentioning

confidence: 99%

A simple, rapid and solvent free nucleic acid extraction protocol for detection of banana bunchy top virus by polymerase chain reaction and loop-mediated isothermal amplification

2015

View full text Add to dashboard Cite

Banana is known to have high content of polyphenols, polysaccharides and tannins which inhibits polymerase chain reaction (PCR) while detecting the viral pathogens. Multiple-step nucleic acid (NA) extraction protocols are common, but more expensive, time consuming, laborious, and may lead to cross contamination. A simple extraction protocol (SEP) for preparing viral NA from leaves and aphids for detection of BBTV by PCR was developed. Inclusion of sodium sulphite and polyvinylpyrrolidone in the extraction buffer minimized the interferences due to polyphenols and polysaccharides, and an homogenization step has increased the percent detection from plants exhibiting various types of symptoms over virus release protocols reported previously. The detection efficacy for the template obtained in this SEP was comparable with that of templates obtained with a CTAB method and a commercial DNA extraction kit for NA extract preparation. The sensitivity test in PCR showed that this assay could detect 0.1 pg/μl plasmid DNA which is equivalent to 1× 10 4 copies. Virus could be detected using SEP from freeze dried as well as CaCl 2 dried samples of BBTV infected banana leaves. This methodology provides quality PCR product for direct sequencing suitable for identification and characterization of BBTV. The NA extract prepared by SEP is suitable for BBTV detection in quantitative PCR using SYBR Green chemistry and loop-mediated isothermal amplification assay. This protocol is sensitive, rapid, less prone to contamination, economical, and has potential for large-scale application in surveys, surveillance, quarantine, and certification programmes.

show abstract

Molecular Characterization of Geographically Different Banana bunchy top virus Isolates in India

Cited by 31 publications

References 13 publications

Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates

Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates

Banana bunchy top disease (BBTD) symptom expression in banana and strategies for transgenic resistance: A review

A simple, rapid and solvent free nucleic acid extraction protocol for detection of banana bunchy top virus by polymerase chain reaction and loop-mediated isothermal amplification

Contact Info

Product

Resources

About