Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola

Abstract

Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.T reponema denticola, a Gram-negative, spiral-shaped, obligate anaerobe, is a virulent and invasive spirochete that is associated with advanced periodontal disease (1-3). In addition, T. denticola, along with other "red complex" bacteria, contributes to endodontal infection both in humans and in experimental animals (4-6). Although T. denticola primarily cause infections of the oral cavity, they have also been associated with the development of cardiovascular disease (7-10) and other systemic conditions (11,12). A number of putative pathogenic attributes that include: the establishment of a stable biofilm, invasive motility, and the production of various proteases and toxins, have been studied in vitro (4,(13)(14)(15)(16). Moreover, the use of animal models (17) have revealed additional insight into their pathogenesis (14,(18)(19)(20)(21)(22). Efforts to further our understanding of T. denticola biology have been impeded by the fastidious nature and specific genetic restriction modification system of this oral spirochete, particularly in the widely used strain T. denticola ATCC 35405, which has a sequenced and fully annotated genome (23,24,25).Several attempts have been made to develop a reproducible genetic system to study T. denticola (26-29). The ermF-ermAM cassette, originally developed for the mutagenesis of another oral pathogen Porphyromonas gingivalis (27), has frequently be...

pyrF as a Counterselectable Marker for Unmarked Genetic Manipulations in Treponema denticola

“…The upstream flanking region of pyrF and ermB were PCR amplified with primer pairs P 1 -P 2 and P 3 -P 4 , respectively, and then fused together using primers P 1 and P 4 , generating fragment 1. The downstream region of pyrF was PCR amplified with primers P 5 and P 6 and then fused to fragment 1 by PCR using primers P 1 and P 6 , generating pyrF::ermB. The obtained DNA fragment was cloned into the pGEM-T Easy vector (Promega, Madison, WI).…”

“…The cloned pyrFaacC1 fragment was then released by AclI digestion and reinserted into the ampicillin resistance gene in the pGEM-T Easy vector at the same site, yielding the pCounter vector. To target the flgE gene, its upstream (US=) GAATATTTTATATTTTTGTTCATATTGGCGGTAAGTTTAGCCT 5= portion for pyrF inactivation (R) P 3 ATGAACAAAAATATAAAATATTCTC Erythromycin B cassette (ermB) for pyrF inactivation, mutant PCR analysis, and Southern blot probe (F) P 4 TTATTTCCTCCCGTTAAATAATAG Erythromycin B cassette (ermB) for pyrF inactivation, mutant PCR analysis, and Southern blot probe (R) P 5 TATTTAACGGGAGGAAATAATCAGTTTTTAAAATCTTCAA 3= portion for pyrF inactivation (F) P 6 GGGCAAGATTAATTTCTATC 3= portion for pyrF inactivation (R) P 7 AACGTTAATCTCTTAAATATAATAAAT pyrF promoter, pCounter (F) P 8 GTTTTAAGGAGAAGTATAATTTAAAAACTGATGTTGTTTA pyrF promoter, pCounter (R) P 9 TAAACAACATCAGTTTTTAAATTATACTTCTCCTTAAAAC tap1 promoter, pCounter (F) P 10 AACGTTTTAGGTGGCGGTACTTGGGTC aacC1, pCounter (R) P 11 GACGTCCAAGTCAAACTTTTTCTGCT 5= flanking region of flgE, pFlgE in (F) P 12 ATACCCTATATTATACCATAAATTATTGCCTCCTAATTGT 5= flanking region of flgE, pFlgE in (R) P 13 ACAATTAGGAGGCAATAATTTATGGTATAATATAGGGTAT 3= flanking region of flgE, pFlgE in (F) P 14 GACGTCAATTGCTTTTCTATCGGAAG 3= flanking region of flgE, pFlgE in (R) P 15 GTTTACAACATGGGAAATTC 5= flanking region of pyrF, PyrF mut PCR analysis (F) P 16 GAAGATAGAGAAAAAATGAC 3= flanking region of pyrF, PyrF mut PCR analysis (R) P 17 CTATCGTTTCAAGTTCAAGAC flgE, FlgE in , and FlgE out PCR analysis and Southern blot probe (R) P 18 CATCACAGGGCGGAGATCTTC 5= flanking region of flgE, FlgE in , and FlgE out PCR analysis (F) P 19 ATGATGAGATCATTATTTTCGG flgE, Southern blot probe (F) P 20 ATGAACTACATCGACTTATTAAAAAC pyrF, Southern blot probe (F) P 21 TGTTGTTTA TTG CCG TCT CG pyrF, Southern blot probe (R) P 22 ATGTTACGCAGCAGCAACGATG aacC1, Southern blot probe (F) P 23 TTAGGTGGCGGTACTTGGGTC aacC1, Southern blot probe (R)…”

“…5 ducing the pyrF gene back into the chromosome of PyrF mut to create pop-in mutants (FlgE in ) and subsequent pop-out mutants (FlgE out ). The rationale for choosing the flgE gene as a target is that the function of this gene has been well characterized (6,8,14). The location of flgE in a large motility gene operon (31,32) will also help test the advantage of this new gene knockout system in terms of avoiding potential polar effects on downstream genes, a common issue of previous gene knockout methods based on positive selection in T. denticola.…”

“…Due to its fastidious growth requirements, only a few virulence factors have been characterized in T. denticola (for a review, see references 4 and 5). During the last decade, although tremendous efforts have been devoted to the identification of genetic tools, only a few have been developed for the genetic manipulation of T. denticola (6)(7)(8)(9)(10). Even now, genetic manipulation (e.g., gene deletion) of T. denticola is still inefficient and cumbersome (7,11).…”

“…Even now, genetic manipulation (e.g., gene deletion) of T. denticola is still inefficient and cumbersome (7,11). In addition, all of the current genetic tools for T. denticola are built upon positive selection by inserting an antibiotic resistance marker into a targeted gene on the chromosome (6,8,9,12). The drawback of this method is that the insertion of an antibiotic resistance cassette often impairs downstream gene expression, particularly for a gene within a large polycistronic gene cluster.…”