Isolation,in vitropropagation, genetic analysis, and immunogenic characterization of anEhrlichia canisstrain from southeastern Brazil

Abstract

Amplification of the 16S rRNA gene from a blood sample obtained from a dog in southeastern Brazil was used to confirm a naturally acquired Ehrlichia (E.) canis infection. Following isolation and culturing of the new bacterial strain called Uberlândia, partial sequences of the dsb and p28 genes were obtained. The dsb partial sequence of the novel strain was 100% similar to dsb gene sequences of E. canis obtained from different geographic areas around the world. Conversely, the p28 partial sequence for the E. canis Uberlândia strain differed at several nucleotides from other sequences available in GenBank. To confirm the antigenic profile of the Uberlândia strain, an indirect immunofluorescence assay against E. canis antigens was performed using dog sera collected from two different areas in Brazil (Uberlândia and São Paulo). The results suggest that both antigens were able to identify animals seropositive for E. canis in Brazil since these Brazilian strains appear to be highly conserved.

Molecular characterization of Ehrlichia canis from naturally infected dogs from the state of Rio de Janeiro

“…Despite the similarity with the Jaboticabal sequence, significant changes in amino acid sequences were observed with approximately 4% of amino acids showing divergences. In a previous study, Alves [36] described the occurrence of 8 polymorphism points using the deduced amino acid sequence of the p28 gene. These results agree with those observed by Nakaghi [35] and Aguiar [37] that found variable numbers of polymorphismidentified divergences in the number of amino acids of the Fig.…”

Molecular Investigation and Phylogenetic Analysis of Ehrlichia canis in Dogs in Siirt, Turkey

“…Nested PCR method was performed to amplify the 16S rRNA gene region of Ehrlichia canis. ECC (5´ AGAACGAACGCTGGCGGCAAGC-3´) and ECB (5´ CGTATTACCGCGGCTGCTGGCA-3´) primers were used in step 1 of Nested PCR, while ECAN5 (5-CAATTATTTATAGCCTCTGGCTATAGGA-3´) and HE3 (5´ TATAGGTACCGTCATTATCT) were used in step 2 (Murphy et al, 1998;Alves et al, 2014;Makino et al, 2015;Ayan et al, 2020). Protocol for both reactions was followed based on the suggestions of Ayan et al (2020).…”

Molecular Identification of Ehrlichia canis in Rhipicephalus Sanguineus Ticks from Siirt Province

“…The Nested PCR method was used to identify E. canis DNA. In the initial phase, the primers ECC (5´ AGAACGAACGCTGGCGGCAAGC-3´) and ECB (5´ CGTATTACCGCGGCTGCTGGCA-3´) were used to amplify the 16S rRNA gene section, while in the second phase, the E. canis specifi c primer ECAN5 (5-CAATTATTTATAGCCTCTGGCTATAGGA-3´) and the primer HE3 (5´-TATAGGTACCGTCATTATCTTCCCTAT-3´) were used [17][18][19]. The protocol suggested in the studies of Ayan et al (2019) and Ayan et al (2020) was used for the PCR [1,20].…”