Isolation and characterization of a complementary DNA for the nuclear-coded precursor of the .beta.-subunit of bovine mitochondrial F1-ATPase

Breen, Gail A. M.; Holmans, P L; Garnett, Karen E.

doi:10.1021/bi00411a010

Cited by 19 publications

(4 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Again, the ability of poly(U) to compete for BARB2 binding (Figure 5A) supports the importance of the uridylate core within this region for the RNA-protein interaction. Additional support may be found in a comparison of the 3h-UTRs of β-mtATPase mRNA from three different species (Figure 6C), in that some evolutionary conservation of the uridylate core between mouse (the present study), cow [14] and man [15] can be noted. To examine the possibility that recognition of the poly(A) binding site by the BARB1 protein, where the poly(A) tail annealed to the UUUCCUU element, involved secondary structures, we denatured probe D at 95 mC or 70 mC for 5 min before binding.…”

Section: A 22-bp Element With a Uridylate Core Confers Specificity To Barb2supporting

confidence: 75%

A novel principle for conferring selectivity to poly(A)-binding proteins: interdependence of two ATP synthase β-subunit mRNA-binding proteins

et al. 2000

View full text Add to dashboard Cite

Based on electrophoretic mobility-shift assays and UV cross-linking experiments, we present evidence in the present work for the existence of two mammalian cytosolic proteins that selectively interact with the 3'-untranslated region of the mRNA coding for the catalytic beta-subunit of mitochondrial ATP synthase (beta-mtATPase). One of the proteins, beta-mtATPase mRNA-binding protein (BARB)1, is a novel poly(A)-binding protein that specifically binds the poly(A) tail of the beta-mtATPase transcript. BARB1 achieves this mRNA selectivity through its interaction with a second protein, BARB2, that binds the beta-mtATPase mRNA through a 22-bp element with a uridylate core, located 75 bp upstream of the poly(A) tail. Conversely, in the absence of BARB1, BARB2 is still able to bind the beta-mtATPase mRNA, but does so with lower affinity. Thus the interaction between BARB1 and BARB2 and beta-mtATPase mRNA involves the formation of a complex between the two BARB proteins. We conclude that BARB1 and BARB2 selectively bind the 3'-untranslated region of beta-mtATPase mRNA in a novel and interdependent manner. The complex between these two proteins may be involved in post-transcriptional regulation of gene expression.

show abstract

Section: A 22-bp Element With a Uridylate Core Confers Specificity To Barb2supporting

confidence: 75%

A novel principle for conferring selectivity to poly(A)-binding proteins: interdependence of two ATP synthase β-subunit mRNA-binding proteins

et al. 2000

View full text Add to dashboard Cite

show abstract

“…First, the number of bands that are detected depends upon the experimental conditions that are employed in hybridization experiments. For example, in the case of the /3-subunit of ATP synthase Breen et al (1988) have proposed that there is a single bovine gene, whereas we have observed at least four different sequences in bovine DNA that hybridize with its cDNA and we have characterized a closely related pseudogene (J. E. Comparison of cDNA sequences and encoded proteins of heart and liver isoforms of the a-subunit of ATP synthase from bovine mitochondria. The entire partial sequence from the liver clone is shown aligned with the corresponding part of the heart sequence.…”

Section: Resultsmentioning

confidence: 95%

ATP synthase from bovine mitochondria: complementary DNA sequence of the import precursor of a heart isoform of the .alpha. subunit

Walker¹,

Powell²,

Viñas³

et al. 1989

Biochemistry

View full text Add to dashboard Cite

The alpha-subunit of ATP synthase from mitochondria is a major component of the extrinsic membrane sector of the enzyme. It is encoded in nuclear DNA. A family of overlapping complementary DNA clones encoding its precursor has been isolated from a bovine library by using in the first instance a mixture of 128 synthetic oligonucleotides designed on the basis of the known protein sequence, and the sequence of the full-length cDNA has been determined. The deduced protein sequence shows that the alpha-subunit of ATP synthase has a presequence of 43 amino acids that is not present in the mature protein. Presumably it directs the protein into the mitochondrial matrix and is removed during the import process. The encoded protein sequence is also longer by one amino acid at its C-terminal end than the protein isolated from F1-ATPase, but this alanine residue may have been removed artifactually during release of the F1-ATPase particle from the inner mitochondrial membrane. With the exception of one uncertainty caused by an ambiguity at one position in the nucleotide sequence, the mature protein sequence encoded in the cDNA is exactly the same as the sequence determined previously by direct analysis of the protein isolated from bovine heart mitochondria [Walker et al. (1985) J. Mol. Biol. 184, 677-701]. The cDNA sequence differs in 158 nucleotides over a region of alignment of 1097 nucleotides from a partial cDNA for the alpha-subunit that has been isolated from a bovine cDNA derived from liver RNA [Breen (1988) Biochem. Biophys. Res. Commun. 152, 264-269].(ABSTRACT TRUNCATED AT 250 WORDS)

show abstract

“…2910 2930 2950 29~0 2990 AGCGTCGTATTGCCGAACAGGCTGTGGCC~GGCTGAAG~T~ACCTG~GCGATCGCCTG~ATG~GACACC~AGGAT~GGTTAAT~G~CGC~GTATTGC GTGACCGGATTCAGTCGGTcAAAAATA~AAAAAAAATTACTG~GC~ATGC~TCTGGTG~CGGCCG~GGTGCG~CGTGCC~AGG~AGGTGCTTTC [38]), PS 3 [39], Bacillus rnegater~um (Bacillus [40 ]), Rhodospirillum rubrum (R. rubrum [41 ]), Bos taurus mitochondrium (Bovine [42]); part b: 5 subunit: Spinacea oleracea [43], Synechococcus sp. PCC 6103 [ 14], Anabaena sp.…”

Section: Q E I a T Q T~a D L R R I E~a A A Q D L G A E Q~r V I A~l Kmentioning

confidence: 99%

The atp1 and atp2 operons of the cyanobacterium Synechocystis sp. PCC 6803

Lill

Nelson

1991

Plant Mol Biol

View full text Add to dashboard Cite

The two operons atp1 and atp2, encoding the subunits of the F0F1 ATP-synthase, have been cloned and sequenced from the cyanobacterium Synechocystis sp. PCC 6803. The organization of the different genes in the operons have been found to resemble that of the cyanobacteria Synechococcus sp. PCC 6301 and Anabaena sp. PCC 7120. The Synechocystis F0F1 ATP-synthase has nine subunits. A tenth open reading frame with unknown function was detected at the 5' end of atp1, coding for a putative gene product similar to uncI in Escherichia coli. A promoter structure was inferred for the Synechocystis atp operons and compared to other known promoters of cyanobacteria. Even though the operon structure of atp1 and atp2 in Synechocystis resembles the corresponding operons of Synechococcus, the amino acid sequences of individual gene products show marked differences. Genetic distances between cyanobacterial genes and genes for ATP-synthase subunits from other species have been calculated and compiled into evolutionary trees.

show abstract

Isolation and characterization of a complementary DNA for the nuclear-coded precursor of the .beta.-subunit of bovine mitochondrial F1-ATPase

Cited by 19 publications

References 47 publications

A novel principle for conferring selectivity to poly(A)-binding proteins: interdependence of two ATP synthase β-subunit mRNA-binding proteins

A novel principle for conferring selectivity to poly(A)-binding proteins: interdependence of two ATP synthase β-subunit mRNA-binding proteins

ATP synthase from bovine mitochondria: complementary DNA sequence of the import precursor of a heart isoform of the .alpha. subunit

The atp1 and atp2 operons of the cyanobacterium Synechocystis sp. PCC 6803

Contact Info

Product

Resources

About