Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter

Abstract

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

Krüppel-like factor 5 promotes breast cell proliferation partially through upregulating the transcription of fibroblast growth factor binding protein 1

“…In agreement with the luciferase results described above, the wild-type (wt), but not the mutant, biotinylated oligonucleotides from the FGF-BP promoter efficiently pull down the KLF5 protein overexpressed in MCF7 (Figure 4c, left). Interestingly, the wt oligonucleotides from the FGF-BP promoter pull down even more KLF5 than the positive control oligonucleotides from the mouse lactoferrin gene (Shi et al, 1999). These results were confirmed by a competition assay (Figure 4c, right).…”

“…The mutant oligonucleotide sequence is 5 0 -CGG CTCCCTCGAAGAGACTTGGCTGGGAGG-3 0 . An oligo (5 0 -GATCGGGCAATAGGGTGGGGCCAGCCC-3 0 ) binding to KLF5 was used as a positive control (Shi et al, 1999).…”

Induction of lactoferrin gene expression by innate immune stimuli in mouse mammary epithelial HC-11 cells

“…6) which prevents nuclear translocation of NF-κB suggesting that a NF-κB binding element is present in the mouse LF promoter. Recently, Kruppel-likefactor 5 (KLF5), a member of the Kruppel-like factors family of transcription factors [43,44] which we have cloned and identified as a mouse LF mitogen response unit (MRU) binding protein [45], was thought to be an important mediator for LPS-induced proinflammatoy response in intestinal epithelial cells [40]. Therefore, LPS could activate LF expression by enhancing the expression or activity of KLF5 in HC-11 cells.…”

“…By using the inhibitors we showed that JNK and p38 MAPK, and PKC pathways are indeed involved in LPS induction of LF expression in HC-11 cells. Previously, we found that transcription factors such as AP1, c-fos and c-jun, Sp1, Sp3 and KLF5 bind to the GT-box, AP1 and CRE binding elements of the mouse LF MRU and activate the transcriptional activity of the promoter [18,45,46]. These transcription factors could be recruited to mediate the MAPK and PKC signals activated by LPS exposure and stimulate the transcriptional activity of the LF gene.…”

A possible tumor suppressor role of the KLF5 transcription factor in human breast cancer

“…This family of transcription factors is involved in several aspects of tumorigenesis, including growth control, apoptosis, and angiogenesis (Black et al, 2001). It has been demonstrated that KLF5 can bind to CACCC motifs and thereby regulate the expression of other genes (Conkright et al, 1999;Shi et al, 1999). Another member of this family, KLF4, is significantly downregulated during intestinal tumorigenesis (Ton-That et al, 1997).…”