We have shown previously that estrogen-stimulated transcription from the human lactoferrin gene in RL95-2 endometrium carcinoma cells is mediated through an imperfect estrogen response element (ERE) at the 5-flanking region of the gene. Upstream from the ERE, a DNA sequence (؊418 to ؊378, FP1) was selectively protected from DNase I digestion by nuclear extracts from endometrial and mammary gland cell lines. In this report, using the electrophoresis mobility shift assay, site-directed mutagenesis, and DNA methylation interference analyses, we show that three different nuclear proteins bind to the FP1 region (C1, C2, and C3 sites). The nuclear receptor, COUP-TF, binds to the C2 site. Mutations in the C1 binding region abolish C1 complex formation and reduce estrogen-dependent transcription from the lactoferrin ERE. When the imperfect ERE of the lactoferrin gene is converted to a perfect palindromic structure, the enhancing effect of the C1 binding element for estrogen responsiveness was abolished. We isolated a complementary DNA (cDNA) clone from an RL95-2 expression library that encodes the C1 site-binding protein. The encoded polypeptide maintains 99% amino acid identity with the previously described orphan nuclear receptor hERR1. A 2.2-kilobase mRNA was detected in RL95-2 cells by the newly isolated cDNA but not by the first 180 base pair of the published hERR1 sequence. By Western analysis, a major 42-kDa protein is detected in the RL95-2 nuclear extract with antibody generated against GST-hERR1 fusion protein. Finally, we show that the hERR1 interacts with the human estrogen receptor through protein-protein contacts.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

No abstract