HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

Abstract

Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter cohort, thus support the pertinence of HLA-G haplotypes as predictive genetic markers for asthma.

Maternal HLA Ib Polymorphisms in Pregnancy Allo-Immunization

“… No multiple imputation was used (Logistic Regression). The HLA-G haplotype identification numbers (HLA-G H02, H04, H21) were coded as previously described ( 44 , 46 ). HLA-G H02 and H04 are associated with UTR4 and HLA-G H21 is associated with UTR5.…”

“…The HLA-G UTR4 haplotype, in linkage disequilibrium (LD) with G*01:01:01:05 ( 44 ), and the HLA-F allele F*01:03:01 were both associated with absence of HLA class I antibody complement activation (respectively p = 0.028; OR = 0.1, CI [0.01-0.8]; and p = 0.046; OR = 0.1, CI [0.01-0.97]; Table 3 ) and higher IgG4 expression (Wilcoxon-Mann-Whitney, respectively p = 0.03, 1200.2 ( ± 975.9) IU/mL vs. 671.5 ( ± 552.7) IU/mL; and p = 0.05, 1165.6 ( ± 959.5) IU/mL vs . 681.8 ( ± 549.4) IU/mL, Table 4 ).…”

“…undergoing infertility treatment (51) and was found more frequent in healthy individuals than in asthmatic patients (44). Concerning HLA-F, in silico analysis reported equivalent mRNA expression in F*01:03 and F*01:01:01 (40).…”

“…High-resolution typing of HLA-G regulatory regions (H1 to H74) was performed according to all polymorphic variations from position -1983 to -1 in the 5’UTR and from +2540 to +3447 in the 3’UTR. The HLA-G haplotype identification numbers were coded as previously described ( 44 , 46 ). Allelic, UTR and haplotype frequencies were estimated using PHASE and an EM algorithm implemented in the Gene[Rate] computer tools ( 47 ).…”

“…Mothers were typed for HLA-E, -F and -G. Furthermore, the HLA-G haplotype based on the regulatory regions was also sequenced. The HLA Ib genes were sequenced by NGS (42)(43)(44). The HLA-E gene was sequenced from position -257 to +3072 (primer sequences were TCATCTCTGTGGGCTACGTG and TCAGACCCCCAGAATCTCAC); the HLA-F gene was sequenced from position -266 to +3249 (GTGGCTCTC AAGGGCTCAG and GCAACAACCAAAGCATCGTA); the HLA-G gene was sequenced from position -1983 to +3447 (primer sequences: AGGAGCTGACACAGGAGGAA and CAGCTGAGCAGTGACCACAT).…”