Grouping in Rhizoctonia Solani by Hyphal Anastomosis Reaction

Carling, D. E.

doi:10.1007/978-94-017-2901-7_3

Cited by 191 publications

(109 citation statements)

References 22 publications

Supporting

Mentioning

106

Contrasting

Unclassified

Order By: Relevance

“…Currently, there are several accepted classifications based on the anastomosis group (AG) concept for both multinucleate (Thanatephorus) and binucleate (Ceratobasidium) taxa within the Rhizoctonia species complex (Carling, 1996). In the first group of taxa, 14 anastomosis groups have been described (Table 2) (Carling et al, 1999(Carling et al, , 2002a, including 13 different groups (named from AG 1 to AG 13) whose members are generally only capable of fusing hyphae among themselves.…”

Section: Biology Of Rhizoctonia Speciesmentioning

confidence: 99%

See 1 more Smart Citation

Review. Biology and systematics of the form genus Rhizoctonia

García¹,

Onco

Susan

2006

Span. j. agric. res.

202

View full text Add to dashboard Cite

Members of the form genus Rhizoctonia D.C. are considered as a complex mixture of filamentous fungi, having in common the possession of a non-spored imperfect state, usually referred to as the Rhizoctonia anamorph. The group includes several of the most devastating crop pathogens like Thanatephorus cucumeris (Frank) Donk (anamorph = Rhizoctonia solani Kühn), the majority of orchid mycorrhizal symbionts (mainly belonging to genus Ceratobasidium D.P. Rogers) and a collection of saprotrophic organisms of different systematic placement. The Rhizoctonia anamorph is characterized by several common features present among members of the entire Rhizoctonia species complex. Taxa from the group have been rearranged into several groups of higher fungi, including both Ascomycota and Basidiomycota, and split into several genera, employing criteria such as the analysis and ultrastructural comparison of septal apparatus. Until very recently, classification for some of the groups within the complex has been exclusively based on criteria such as hyphal anastomosis, since other types of diagnostic features are usually scarce in these fungi. Phytopathological studies in the complex have represented the major contingent of contributions in the group, especially in the case of R. solani. Some members of the complex have been reported to be protective isolates against pathogenic members of Rhizoctonia and some other fungal pathogens. This review focuses on the knowledge of several aspects of the species of Rhizcotonia s. lato, such as its current taxonomic placement, the biology and systematics of some groups of the complex, and a revision of the methodologies employed in studying it.Additional key words: Basidiomycetes, biocontrol, Ceratobasidiaceae, Ceratobasidium, fungal diseases, methodology, taxonomy, Thanatephorus. Resumen Biología y Sistemática del género forma RhizoctoniaLos miembros del género forma Rhizoctonia D.C. son considerados como un complejo de hongos filamentosos, presentando en común una fase asexual no productora de esporas, denominada anamorfo tipo Rhizoctonia. El grupo incluye algunos importantes patógenos como Thanatephorus cucumeris (Frank) Donk (anamorfo=Rhizoctonia solani Kühn), la mayoría de especies micorrícicas de orquídeas (principalmente del género Ceratobasidium D.P. Rogers), y algunos taxones de posición taxonómica variada. El anamorfo tipo Rhizoctonia es definido por una serie de características, presentes y comunes en todos los taxones del complejo. Los taxones del grupo han sido distribuidos entre varios grupos de hongos, incluyendo Ascomicetes y Basidiomicetes, y reubicados en varios géneros de ambas clases, empleando criterios de clasificación tales como el análisis y comparación de la ultraestructura del aparato septal. Habitualmente, la clasificación en algunos de los grupos del complejo ha estado basada en la aplicación de criterios tales como la anastomosis hifal, debido a que en este tipo de hongos es escasa la presencia de un número aceptable de caracteres diagnósticos. Los trabajos ...

show abstract

Section: Biology Of Rhizoctonia Speciesmentioning

confidence: 99%

“…AG 1, AG 2, AG 4, AG 6 and AG 9) (Table 2), based on criteria different to anastomosis pairing, including pathogenicity, colony morphology, DNA complementarity, pectic zymograms, etc. (Carling, 1996).…”

Section: Biology Of Rhizoctonia Speciesmentioning

confidence: 99%

Review. Biology and systematics of the form genus Rhizoctonia

García¹,

Onco

Susan

2006

Span. j. agric. res.

202

View full text Add to dashboard Cite

show abstract

“…are classified in different species or groups on the basis of morphological and cultural characters (Parmeter & Whiteny, 1970). Isolates of R. solani have been traditionally classified into different anastomosis groups (AGs) (Ogoshi, 1987;Carling, 1996).…”

Section: Introductionmentioning

confidence: 99%

Influence of Weather and Soil Parameters on Development of Wet Root Rot in Pulse Crops and Virulence Analysis of Rhizoctonia solani Isolates

Dubey¹,

Tripathi²,

Upadhyay³

et al. 2012

JAS

View full text Add to dashboard Cite

Wet root rot caused by Rhizoctonia solani Kühn in pulse crops was favored by wide range of soil parameters like temperature, humidity, pH, electric conductivity and soil texture. The areas surveyed for the collection of the isolates showing variable atmospheric temperature and relative humidity and low to medium levels of soil organic carbon and high level of available phosphorus influenced the development of the disease incidence from 2-48%. Seventy three cultivars of mungbean, twenty eight cultivars of urdbean and eight cultivars of cowpea were evaluated against virulent isolate of R. solani (RASC 30) to design a set of differential cultivars for virulence analysis. Two cultivars of urdbean, namely, NDU3-4 and IPU2-14, one cultivar of mungbean, namely, HUM 1 and three cultivars of cowpea, namely, V240, V585 and DCP7 showed resistant reactions. Four cultivars of urdbean, namely, TU94-2, KU323, KUG216 and B3-8-8, one cultivar of mungbean, namely, PDM54 and two cultivars of cowpea, namely, V578 and DCP13 were moderately resistant against the pathogen. The virulence analysis of 90 isolates of the pathogen representing 7 anastomosis groups (AGs) isolated from pulse crops of 16 agro-ecological regions of India on a set of differential cultivars, namely, HUM 1, PDM 54 and Pusa Vishal of mungbean, NDU 3-4, KU 323, Uttara of urdbean and V 240, V 578 and Pusa Sukomal of cowpea grouped the isolates into five pathotypes. The differential cultivar for each pathotype was identified. The pathotypes were not corresponding to the AG type of the isolates. Except one pathotype (isolate RMPG28 belonging to AG2-3), each pathotype had the isolates from different AGs.

show abstract

“…black scurf on the surface [2]. There are many different isolates of Rhizoctoniasolani that are classified based on the anastomosis groups (AG's) [3][4][5]. These strains contain double-stranded RNA (dsRNA).…”

mentioning

confidence: 99%

“…Each anastomosis group is made up of R. solani isolates which are capable of physically touching each other, fusing and sharing materials, such as nutrients. If the isolates do not belong to the same anastomosis group, then cell death can occur at the point of physical contact of the mycelia [4,5]. One study, which examined 36 isolates of R. solani from nine anastomosis groups, found that every isolate contained double-stranded (ds) RNA.…”

mentioning

confidence: 99%

Primer/Probe Optimization of RTq-PCR for Identification of Double-stranded (ds) RNA in Rhizoctonia solani

Chey¹,

Long²,

Bharathan³

et al. 2015

JLS

View full text Add to dashboard Cite

Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups (AG's). Many isolates of these fungi contain double-stranded viral RNA (dsRNA) that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle (M)-size dsRNA fragments from R. solani have been very difficult primarily due to artifacts that co-purify including large (L)-size dsRNA in the fungus. Various MgCl 2 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgCl 2 concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR (RTqPCR) with the primers (reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC) and probe (5' Fam-AGTGCCGATCAGCCCTCCACCG-BHQ1 3'). The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration (C t ) values using the plasmid cDNA as a template.

show abstract

Grouping in Rhizoctonia Solani by Hyphal Anastomosis Reaction

Cited by 191 publications

References 22 publications

Review. Biology and systematics of the form genus Rhizoctonia

Review. Biology and systematics of the form genus Rhizoctonia

Influence of Weather and Soil Parameters on Development of Wet Root Rot in Pulse Crops and Virulence Analysis of Rhizoctonia solani Isolates

Primer/Probe Optimization of RTq-PCR for Identification of Double-stranded (ds) RNA in Rhizoctonia solani

Contact Info

Product

Resources

About