Stable epigenetic changes appear uncommon, suggesting that changes typically dissipate or are repaired. Changes that stably alter gene expression across generations presumably require particular conditions that are currently unknown. Here we report that a minimal combination of cis-regulatory sequences can support permanent RNA silencing of a single-copy transgene and its derivatives in C. elegans simply upon mating. Mating disrupts competing RNA-based mechanisms to initiate silencing that can last for >300 generations. This stable silencing requires components of the small RNA pathway and can silence homologous sequences in trans. While animals do not recover from mating-induced silencing, they often recover from and become resistant to trans silencing. Recovery is also observed in most cases when double-stranded RNA is used to silence the same coding sequence in different regulatory contexts that drive germline expression. Therefore, we propose that regulatory features can evolve to oppose permanent and potentially maladaptive responses to transient change.
Gene silencing is a significant obstacle to genome engineering and has been proposed to be a non-self response against foreign DNA 1,2,3,4 . Yet, some foreign genes remain expressed for many generations 1,3,4 and some native genes remain silenced for many generations 1,5,6 . How organisms determine whether a sequence is expressed or silenced is unclear. Here we show that a stably expressed foreign DNA sequence in C. elegans is converted into a stably silenced sequence when males with the foreign DNA mate with wild-type hermaphrodites. This conversion does not occur when the hermaphrodite also has exonic sequences from the foreign DNA. Once initiated, silencing persists for many generations independent of mating and is associated with a DNA-independent signal that can silence other homologous loci in every generation. This mating-induced silencing resembles piRNA- generations. Thus, our results reveal the existence of a mechanism that maintains gene silencing initiated upon ancestral mating. By allowing retention of potentially detrimental sequences acquired through mating, this mechanism could create a reservoir of sequences that contribute to novelty when activated during evolution. ResultsMating is routinely used to introduce genes, including fluorescent reporters, into different genetic backgrounds and it is generally assumed that gene expression is unaffected by this manipulation. While
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups (AG's). Many isolates of these fungi contain double-stranded viral RNA (dsRNA) that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle (M)-size dsRNA fragments from R. solani have been very difficult primarily due to artifacts that co-purify including large (L)-size dsRNA in the fungus. Various MgCl 2 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgCl 2 concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR (RTqPCR) with the primers (reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC) and probe (5' Fam-AGTGCCGATCAGCCCTCCACCG-BHQ1 3'). The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration (C t ) values using the plasmid cDNA as a template.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.