Genome-wide identification of OSCA gene family and their potential function in the regulation of dehydration and salt stress in Gossypium hirsutum

Abstract

Background: Cotton (Gossypium hirsutum) provides the largest natural fiber for the textile manufacturing industries, but its production is on the decline due to the effects of salinity. Soil salt-alkalization leads to damage in cotton growth and a decrease in yields. Hyperosmolality-gated calcium-permeable channels (OSCA) have been found to be involved in the detection of extracellular changes which trigger an increase in cytosolic free calcium concentration. Hyperosmolality-induced calcium ion increases have been widely speculated to be playing a role in osmosensing in plants. However, the molecular nature of the corresponding calcium ion channels remains unclearly. In this research work, we describe the OSCA genes and their putative function in osmosensing in plants by carrying out genomewide identification, characterization and functional analysis of the significantly up-regulated OSCA gene, GhOSCA1.1 through reverse genetics. Result: A total of 35, 21 and 22 OSCA genes were identified in G. hirsutum, G. arboreum, and G. raimondii genomes, respectively, and were classified into four different clades according to their gene structure and phylogenetic relationship. Gene and protein structure analysis indicated that 35 GhOSCA genes contained a conserved RSN1_7TM (PF02714) domain. Moreover, the cis-regulatory element analysis indicated that the OSCA genes were involved in response to abiotic stress. Furthermore, the knockdown of one of the highly up-regulated genes, Gh_OSCA1.1 showed that the virus-induced gene silenced (VIGS) plants were highly sensitive to dehydration and salinity stresses compared with the none VIGS plants as evident with higher concentration levels of oxidant enzymes compared with the antioxidant enzymes on the leaves of the stressed plants. Conclusion: This study provides the first systematic analysis of the OSCA gene family and will be important for understanding the putative functions of the proteins encoded by the OSCA genes in cotton. These results provide a new insight of defense responses in general and lay the foundation for further investigation of the molecular role played by the OSCA genes, thereby providing suitable approaches to improve crop performance under salinity and drought stress conditions.

GhGLK1 a Key Candidate Gene From GARP Family Enhances Cold and Drought Stress Tolerance in Cotton

“…Under drought circumstances, the concentrations of oxidant (MDA and H 2 O 2 ) and antioxidant (CAT and POD) enzymes in GhMPK3 silenced, and WT plants were determined. The investigation revealed that antioxidant concentrations were much lower in the silenced plants, whereas oxidant levels increased dramatically when compared with the control plants ( Yang et al, 2019 ; Kirungu et al, 2020 ; Sadau et al, 2021 ). Moreover, GLKs confer biological stress resistance in crops.…”

“…Using cDNA as a template, the target gene is amplified according to specific primers (forward: GTGAGTAAGGTTA CCGAATTCAGTGAAGGTGGATTGGACGC and reverse: CGTGAGC GGTACCGGATAGCCCCCCCCGCATATGATTGC TCTG). The VIGS vector construction was made using the double enzyme cutting method of Eco RI and Bam HI enzymes ( Yang et al, 2019 ). The required cultures are TRV2:GhGLK1, empty TRV2:00, and TRV2: PDS.…”

Identification of OSCA gene family in Solanum habrochaites and its function analysis under stress

“…Twelve OSCA gene family members were identified in maize, including ZmOSCA4.1 gene, which response to drought stress [ 21 ]. In G. hirsutum, G. arboretum and G.raimondii , 35, 21 and 22 gene family members were identified, respectively, including GhOSCA1.1 a key gene involved in drought and salt tolerance [ 22 ]. Recent studies have shown that OSCA responds to plant immune response.…”

Integrated transcriptome and proteome analysis reveals complex regulatory mechanism of cotton in response to salt stress

“…It is very important to improve salt tolerance based on ensuring high yield and quality in cotton. Transcriptome and proteome have made progress in revealing the mechanism of salt tolerance and identifying candidate genes in cotton (Gong et al 2017;Guo et al 2015;Li et al 2015;Peng et al 2014;Shan et al 2019;Sikder et al 2020;Yang et al 2019). As there are multi-level regulatory machineries exist in saltstress response, including transcription and translation regulations, it is important to monitor the gene expression level of RNA and protein simultaneously.…”

“…As there are multi-level regulatory machineries exist in saltstress response, including transcription and translation regulations, it is important to monitor the gene expression level of RNA and protein simultaneously. Fortunately, the development of integrated transcriptome and proteome makes this research strategy possible (Chen et al 2015;Peng et al 2018;Trevisan et al 2015;Wang et al 2014;Yang et al 2019).…”