Eosinophilic Fasciitis Associated with Mycoplasma arginini Infection

Abstract

Eosinophilic fasciitis (EF) with generalized sclerodermiform skin lesions developed over a 19-month period in a previously healthy 23-year-old man. Although we confirmed EF by skin histology and laboratory tests, the recurrent fevers and the clinical observation of sclerotic prepuce with urethritis indicated further bacteriological analysis by conventional microbiological and DNA-based tests. Urethra cultures were positive for an arginine-hydrolyzing mycoplasma and Ureaplasma urealyticum. The patient also had serum IgM antibodies to Mycoplasma pneumoniae using enzyme-linked immunosorbent assay (ELISA)-based qualitative detection. Mycoplasma arginini was isolated from two independent venous blood serum samples and was identified by conventional microbiological tests and sequencing of the 16S rRNA and rpoB genes (GenBank sequence accession numbers HM179555 and HM179556, respectively). M. arginini genomic DNA also was detected by species-specific PCR in the skin lesion biopsy sample. Treatment with corticosteroids and long-term courses of selected antibiotics led to remission of skin symptoms and normalization of laboratory values. This report provides the first evidence of EF associated with mycoplasma infection and the second report of human infection with M. arginini and therefore suggests that this mycoplasma infection might have contributed to the pathogenesis of the disease. CASE REPORTA 23-year-old male, a former bodybuilder, sought medical treatment for progressive generalized skin tightening. His previous medical history was unremarkable. The patient had terminated sport exercises 19 months earlier due to a sudden, progressive skin induration, which led to restricted movement of wrists and ankles within several months, and cutaneous symptoms gradually extended to the extremities and to the upper body. At the beginning of his illness, he quit body building and stopped anabolic steroid consumption. Within 1 year, he lost 23 kg, he became febrile in the afternoons, and his skin disease slowly progressed. Serological tests for HIV, hepatitis C virus (HCV), and Lyme borreliosis were negative. His crista biopsy specimen revealed eosinophilia. The patient was treated with a very low dose of prednisone (10 mg/day orally [p.o.]) for the next 6 months without dermatological improvement. Any attempt to decrease the prednisone dosage resulted in return of arthralgia and fever.Upon initial examination, the patient suffered from generalized skin tightening and tautness on his whole trunk and on all the extremities except the fingers and toes. He also exhibited multiple cutaneous venous furrowing on the arms (Fig. 1). The shiny, brownish, firm skin with some porcelain-whitish patches was tightly bound to the underlying tissues, resulting in a restricted movement of the chest, wrists, elbows, ankles, and knees. The genital region was also involved; the indurated, sclerotic, depigmented prepuce led to phimosis and showed lichen sclerosus-like symptoms with an inflamed urethral orifice.Initial laboratory tests showed periph...

Eosinophilic Fasciitis in a Patient with Hepatitis C Virus Infection: Coincidence or Association?

“…Concerning to infections, there are description of eosinophilic fasciitis associated to intestinal parasitic infection [17], Mycoplasma arginini (18), tuberculosis (19) and borrelia [5,20,21]. However, until the present moment, there have no described cases of eosinophilic fasciitis in patient with hepatitis C virus infection.…”

Clinical characteristics and causes of erythema exsudativum multiforme, Stevens-Johnson syndrome and toxic epidermal necrolysis

“…A saját friss esetek feldolgozása tükrözi az aktuális gyógyszer használat során jelentkezô adverz reakciókat és összecseng más kórképek (akut generalizált exanthematosus pustulosis, eosinophil fasciitis, Behçet-kór, erythema nodosum) etioló-giájából ismert kórokozókkal (25,26,27,28,29).…”

Mycoplasma arginini: high frequency involvement in goat pneumonia

“…For identification of M. arginini, the PCR was performed with species-specific primers targeting the rpoB gene (F 5' TTTGACGGGGTTGTAACATACGT 3' and R 5' CAGCTAATCCTAGGTGTAATTC GAG 3') as described by Sillo et al (22).…”