Enzymatic Verification and Comparative Analysis of Carrageenan Metabolism Pathways in Marine Bacterium Flavobacterium algicola

Abstract

Carrageenan is the main polysaccharide of red macroalgae and is composed of d -AHG and d -Gal. The carrageenan PUL (CarPUL)-encoded enzymes exist in many marine bacteria for decomposing carrageenan to provide self-growth. Here, the related enzymes in Flavobacterium algicola for metabolizing carrageenan were characterized for describing the catabolic pathways, notably, although the specific polysaccharide hydrolases existed that were like previous studies.

Comparative Study on Enzymatic Characteristics of Two κ-Carrageenases from Carrageenan-Degrading Bacterium Catenovulum agarivorans DS2

“…WP_035014434.1). This brings us a novel understanding of the roles of κ-carrageenases in the B/KC metabolic pathway of the carrageenan-degrading bacteria, while previous reports only focused on their roles in the KC metabolic pathway. , …”

“…SY01, 7 Car3026 from Polaribacter sp. NJDZ03, 28 and OUC-FaKC16A from F. algicola, 29 the products of which were Nκ2, Nκ2, and Nκ4, respectively. Thus, CaKC16A and CaKC16B described here have the potential to be promising tools for the preparation of Nκ4 and Nκ2, respectively.…”

Membranihabitans maritimus sp. nov., a marine bacterium isolated from deep seawater

“…These enzymes may help strain C281 T degrade algae polysaccharides for self-growth requirements, as well as releasing carbon dioxide in oligotrophic marine environments. The polysaccharide synthesis by macroalgae and polysaccharide metabolism by marine bacteria usually constitute the carbon cycle of a marine ecosystem [47]. The COG analysis result showed that types C, E, G, K and S were present in larger proportions in strain C281 T than in other type strains in the family Saprospiraceae , whose coding genes are involved in energy production and conversion, amino acid transport and metabolism, carbohydrate transport and metabolism, transcription and unknown function, respectively.…”

Expression and Biochemical Characterization of a Novel Fucoidanase from Flavobacteriumalgicola with the Principal Product of Fucoidan-Derived Disaccharide

“…Previous studies have shown that the strain type F. algicola TC2 T [ 30 ] could digest the GA-fucoidan extracted Laminaria japonica. Recently, several enzymes that are involved in the carrageenan metabolism pathway and α-L-fucosidase with transfucosylation activity have been discovered, verified, and analyzed in F. algicola [ 31 , 32 ]. However, the enzymes and genes that are responsible for fucoidan degradation in this fucoidan-digesting strain have not been reported.…”

“…On account of the full genome sequence (Accession No. JAJTUT010000001-JAJTUT010000006) of F. algicola 12,076 [ 31 , 32 ], a pair of primers (OUC-FaFcn1F: 5’- CGAATTCGAGCTCCG CAAGTTCCAGATTCCG-3’ and OUC-FaFcn1R: 5’- TCAGTGGTGGTGGTGGTGGTG TTGTTTTATTTTTATG-3’) was designed and synthesized based on the conserved sequences of the genes encoding fucoidanases in M. fucanivornans (CAI47003.1), F. algae (WP_057784217.1 and WP_057784219.1), F. haliotis (WP_066217780.1), and W. fucanilytica CZ1127 T (ANW96098.1 and ANW96097.1) to clone the putative gene encoding fucoidanase from its genomic DNA. The purified DNA products were inserted into the plasmid pET-28a(+) by the homologous sequences that are marked by an underline in primers and sequenced.…”